Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • ChipSEQ on Solexa (low % align, unusable reads)

    Hi,

    I thought there was some discussion, but could not find it - regarding the data output from a chipSEQ run using the Solexa GA.

    There is very little dna to work with, is what the sequencing team says. But after a run through the solexa pipeline, I see under 20% passing-filter reads aligning to the reference genome. That is way too low, and that too with error rate of about 5% !

    Are there any changes or workarounds as to what might be causing it? or its simply blame it on the data! The number of clusters, % pass, intensities all look fine..
    --
    bioinfosm

  • #2
    How many clusters are you getting per tile and what are the sequences that don't align, are they all the adapter sequence perhaps?

    Comment


    • #3
      Originally posted by new300 View Post
      How many clusters are you getting per tile and what are the sequences that don't align, are they all the adapter sequence perhaps?
      Its about 10,000-15,000 PF clusters. I am yet to check match with adapter, is there a dataset I could use to do that? A reference sequence to check for adapter?
      --
      bioinfosm

      Comment


      • #4
        And the phiX control looks perfectly fine .. less than 1% error, good data overall..
        --
        bioinfosm

        Comment


        • #5
          What should be the way to detect adapter contamination in my chipSEQ data?

          I tried using this as reference set for ELAND, but did not work as expected, any ideas? I would simply want to see what % of reads are adapters or adapter dimers, etc.

          >Adapters1a
          GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
          >Adapters1b
          ACACTCTTTCCCTACACGACGCTCTTCCGATCT
          --
          bioinfosm

          Comment

          Latest Articles

          Collapse

          • seqadmin
            The Impact of AI in Genomic Medicine
            by seqadmin



            Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
            02-26-2024, 02:07 PM
          • seqadmin
            Multiomics Techniques Advancing Disease Research
            by seqadmin


            New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

            A major leap in the field has
            ...
            02-08-2024, 06:33 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Yesterday, 06:12 AM
          0 responses
          17 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 02-23-2024, 04:11 PM
          0 responses
          67 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 02-21-2024, 08:52 AM
          0 responses
          73 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 02-20-2024, 08:57 AM
          0 responses
          62 views
          0 likes
          Last Post seqadmin  
          Working...
          X