Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • NicoBxl
    not just another member
    • Aug 2010
    • 264

    #1

    HTS microrna analysis : a brief summary

    Hi everybody,

    I'm working on HTS microrna data ( Illumina GAIIe ) . I open this thread to put all ideas to analyze such data. I think this can help a lot of people.

    Don't hesitate to reply your way to analyze mirna data !

    I created a wiki page, it's more simple for collaborative editing : microRNA Analysis

    I started :

    1. Pre-Processing of raw data

    1.1 Trim the 3' adapter

    Before analyzing the data, the first thing to do is to trimm the 3' adapter. You can find the adapter sequence here or here. In general it's this sequence you have to trimmed : UCGUAUGCCGUCUUCUGCUUGU

    For this purpose, you can use :
    - trimLRPatterns from R
    - BioPerl script
    - Use a alignment program (bowtie, soap, ... ) to align the adapter to the 3' part of the read sequence.
    - ...


    1.2 Filter reads on size

    Because microrna length is between 17-22, you can discard all the reads with a length < 15 .

    1.3 Filter on quality

    You can discard all the reads with a poor quality. I think under 20 (in phred score) , it's not a good quality ( a score of 20 represent 99% of base call acuracy )

    1.4 Alignement to a reference genome

    Align the reads to a reference genome and discard the reads who don't perfectly matche.
    You can use bowtie, soap, maq,...

    1.5 Filtering on other RNA species

    Other RNA, like snoRNA, tRNA, piRNA,... , are maybe present in the reads. To discard this RNAs ( or to analyze them later ), you can match the reads with the RFam database.


    2. Differential Expression Analysis

    Before the DE analysis step, you can align the reads on the mirBase database to find known miRNA. mirAnalyzer can do that.

    To compare different sample, you've got to normalize them. Some methods exist. For this step, I don't know a lot of methods, so I ask you to complete this list :

    - edgeR : a R package to make DE analyze
    - DESeq : an another R package
    - T-test
    - ANOVA

    Some lectures :

    - A scaling normalization method for differential expression analysis of RNA-seq data, Mark D Robinson and Alicia Oshlack
    - Evaluation of statistical methods for normalization and differential expression in mRNA-Seq experiments, James H Bullard, Elizabeth Purdom, Kasper D Hansen and Sandrine Dudoit
    - Differential expression analysis for sequence count data, Simon Anders and Wolfgang Huber
    - Normalization strategies for microRNA profiling experiments: a 'normal' way to a hidden layer of complexity?, Meyer SU, Pfaffl MW, Ulbrich SE.



    3. Prediction of novel microRNA

    After alignement on the mirBase database, some reads may not matching with any miRNA in mirBase. They are maybe unknown miRNA.

    Some methods exist to predict novel miRNAs :

    - mirDeep
    - miTrap
    - ...


    4. Prediction of miRNA Targets

    To predict the targets of the miRNAs, like the differentially expressed per example, some programs exists :

    - TargetScan
    - miRanda
    - PicTar
    - RNAHybird
    - miTarget
    - DIANAmicroT
    - ...


    General lecture :

    - Next Generation Sequencing of miRNAs – Strategies, Resources and Methods, Susanne Motameny, Stefanie Wolters, Peter Nürnberg and Björn Schumacher

    Sorry for my english, I'm not very fluent in English writing

    I'm aware that is a very little part of the analyzing process of the HTS miRNA data .

    Don't hesitate to reply your way to analyze miRNA data !

    Nicolas
    Last edited by NicoBxl; 08-27-2010, 01:04 AM.
  • Nomijill
    Member
    • Sep 2009
    • 25

    #2
    commercial miRNA analysis pipeline

    Dear Nicholas,

    Please let me know what you think about the CLC bio miRNA analysis pipeline. We released it in version 4.0 in June. The feedback that we have had, especially for its speed and ease of use, has been really positive.

    You can download the GWB 4.0 from here: http://clcbio.com/index.php?id=1292
    (it is free to use for two weeks)

    and the small RNA tutorial is available here: http://www.clcbio.com/index.php?id=649

    You can respond to me via SeqAnswers, so everyone can learn from your observations, or feel free to e-mail me. I am at [email protected].

    Thanks for collecting all of this information. I look forward to hearing what you think.
    -Naomi

    Comment

    • Anelda
      Member
      • May 2010
      • 30

      #3
      Hi Naomi,

      I have been testing the CLC pipeline extensively. I had a few questions to our local support. My main concern with the pipeline is that ambiguous reads get assigned randomly when I map my reads to known mirnas from Mirbase. That means I can't compare results if I ran the same analysis twice. I also don't know to which known mirnas the reads map to if it is ambiguous.

      Is there any chance that you can change this in subsequent releases?

      Thanks!
      Anelda

      Comment

      • Nomijill
        Member
        • Sep 2009
        • 25

        #4
        miRNA analysis - making it better!

        Hi Anelda-

        You are right. I looked at your record and I saw your e-mails with your recommendations for improving the miRNA functions. Thanks for passing that on. I am sure your feedback has been registered through your representatives, but I also passed them to my contact in the US, so you will be heard twice.

        Thanks for testing our software, and please keep the comments coming.
        -Naomi

        Comment

        • dzavallo
          Member
          • Apr 2011
          • 16

          #5
          Hi Nicholas:
          I have a question regarding normalization. If I want to do a simple normalization like RPM (reads per millon), which library do I have to use? mappable reads (including mRNA, tRNA, snoRNA, etc, and sRNA) or just mapped reads against mirBase?

          Thanks a lot

          Diego

          Comment

          • jay2008
            Member
            • Sep 2010
            • 44

            #6
            in section 1.3 Filter on quality, are you saying remove reads that include at least one low quality nt?

            Comment

            • NicoBxl
              not just another member
              • Aug 2010
              • 264

              #7
              Originally posted by jay2008 View Post
              in section 1.3 Filter on quality, are you saying remove reads that include at least one low quality nt?
              You can discard the reads with a mean quality under 20.

              Comment

              • NicoBxl
                not just another member
                • Aug 2010
                • 264

                #8
                Originally posted by dzavallo View Post
                Hi Nicholas:
                I have a question regarding normalization. If I want to do a simple normalization like RPM (reads per millon), which library do I have to use? mappable reads (including mRNA, tRNA, snoRNA, etc, and sRNA) or just mapped reads against mirBase?

                Thanks a lot

                Diego
                I thnik it's better to use mappable reads (mRNA,snoRNA,...) . Ask Simon Andrews who works on DESeq, he can probably help you better than me..

                Comment

                • jay2008
                  Member
                  • Sep 2010
                  • 44

                  #9
                  thanks NicoBxl,
                  before adapter trimming or after adatper trimming?

                  Comment

                  • NicoBxl
                    not just another member
                    • Aug 2010
                    • 264

                    #10
                    I think I did it after

                    Comment

                    • jay2008
                      Member
                      • Sep 2010
                      • 44

                      #11
                      I can not find piRNA from http://rfam.janelia.org/.
                      can you please give me more detailed info. ?

                      thanks
                      Yu

                      Comment

                      • NicoBxl
                        not just another member
                        • Aug 2010
                        • 264

                        #12

                        Comment

                        • dzavallo
                          Member
                          • Apr 2011
                          • 16

                          #13
                          thanks! But who is Simon Andrews, and how can I contact him?

                          Originally posted by NicoBxl View Post
                          I thnik it's better to use mappable reads (mRNA,snoRNA,...) . Ask Simon Andrews who works on DESeq, he can probably help you better than me..

                          Comment

                          • NicoBxl
                            not just another member
                            • Aug 2010
                            • 264

                            #14
                            Originally posted by dzavallo View Post
                            thanks! But who is Simon Andrews, and how can I contact him?
                            he's on this board

                            Comment

                            • Mammon
                              Junior Member
                              • Jul 2010
                              • 3

                              #15
                              Should we be aligning first to the genome and then to miRBase or the other way around? Or is it dependent on the reference genome used? I'm working with mouse samples and after mapping 16 million reads to the mouse genome I was left with only ~400,000 that actually mapped. I was later told that the mouse genome isn't well annotated and that only areas around the genes are mapped, and a lot of intergenic space is not.

                              I would think that I should just align to miRBase to find existing miRNAs, and then go and align to the mouse genome when I'm looking at potential new locations of miRNAs or for novel miRNAs. Does this make sense?

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 08-13-2026, 12:22 PM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-11-2026, 10:35 AM
                              0 responses
                              24 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-06-2026, 07:41 AM
                              0 responses
                              38 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-03-2026, 10:13 AM
                              0 responses
                              51 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...