cutadapt: A tool that removes adapter sequences

[bioinfosm]

cool, that was fast!

[mmartin]

Good idea. Since this was on my to do list as well, I have just implemented this feature and released cutadapt 0.6.

[sdavis]

This looks a very useful tool. Could I suggest that you accept gzipped fastq files as an alternative input format as a simple convenience?

[HiroMishima]

Hi, actually, you do have to use two -a options since currently reverse complements are not automatically searched for.

I managed to reproduce the problem you encountered and I have prepared a new release that hopefully fixes it. You can download v0.4 from the homepage and see whether the bug is actually fixed. Thanks for reporting this!

Everything's perfect! cutadapt 0.5.1 worked well with two -a options.

I believe that cutadapt is one of the best adopter sequence trimmer especially in term of simpleness and speed.

Thanks again for prompt update.

[mmartin]

Since this isn't too hard, I just added that feature. cutadapt now has the option "--discard", which does exactly that: If an adapter is found in the read, then the read is discarded and not trimmed.

[gaffa]

I haven't looked into the details of the program, but I wonder how straightforward it would be to use the program to filter out and discard the entire reads that match an adapter, rather just removing that part and re-using the trimmed read?

[mmartin]

Hi, actually, you do have to use two -a options since currently reverse complements are not automatically searched for.

I managed to reproduce the problem you encountered and I have prepared a new release that hopefully fixes it. You can download v0.4 from the homepage and see whether the bug is actually fixed. Thanks for reporting this!

[HiroMishima]

Could you give an example of the problematic read you encounter and the output of cutadapt for that read?

I found that I used two -a options and used adapter sequences were almost reverse complement each other. Probably I do not have to use two -a options in this case. Hopefully, these examples clarify the situation.

sample.fastq:

@read1
GATCCTCCTGGAGCTGGCTGATACCAGTATACCAGTGCTGATTGTTGAATTTCAGGAATTTCTCAAGCTCGGTAGC
+
hhhhhhhhhhahhhhhehhffhghhehdgghhheddggfhfhhgffhddhhfffhhffhfgggffddfdfffcdfb
@read2
CTCGAGAATTCTGGATCCTCTCTTCTGCTACCTTTGGGATTTGCTTGCTCTTGGTTCTCTAGTTCTTGTAGTGGTG
+
hhhhhhhhhhhhhhhhhhhhhhhhhhgghghhhhhhhhgaddeeadaa^dadaa_aaaaababca_aa__^[T^[Z

And next result is OK:

$python cutadapt -a CTCGAGAATTCTGGATCCTC sample.fastq

@read1
CTGGAGCTGGCTGATACCAGTATACCAGTGCTGATTGTTGAATTTCAGGAATTTCTCAAGCTCGGTAGC
+
hhhahhhhhehhffhghhehdgghhheddggfhfhhgffhddhhfffhhffhfgggffddfdfffcdfb
@read2
TCTTCTGCTACCTTTGGGATTTGCTTGCTCTTGGTTCTCTAGTTCTTGTAGTGGTG
+
hhhhhhgghghhhhhhhhgaddeeadaa^dadaa_aaaaababca_aa__^[T^[Z

However, in next results, read1 still contains "GATCCTC" in the 5' end:

$python cutadapt -a CTCGAGAATTCTGGATCCTC -a GAGGATCCAGAATTCTCGAGTT sample.fastq

@read1
GATCCTCCTGGAGCTGGCTGATACCAGTATACCAGTGCTGATTGTTGAATTTCAGGAATTTCTCAAGCTCGGTAGC
+
hhhhhhhhhhahhhhhehhffhghhehdgghhheddggfhfhhgffhddhhfffhhffhfgggffddfdfffcdfb
@read2
TCTTCTGCTACCTTTGGGATTTGCTTGCTCTTGGTTCTCTAGTTCTTGTAGTGGTG
+
hhhhhhgghghhhhhhhhgaddeeadaa^dadaa_aaaaababca_aa__^[T^[Z

[mmartin]

Yes, cutadapt recognizes partial adapters. That is, if your adapter is ADAPTER and your read is MYSEQUENCEADAP, then the resulting sequence is MYSEQUENCE. In fact, these are some examples of input sequences that will result in MYSEQUENCE:
MYSEQUENCEADAPTER
MYSEQUENCEADAP
MYSEQUENCEADPAPTERSOMETHINGELSE

Could you give an example of the problematic read you encounter and the output of cutadapt for that read?

[HiroMishima]

3'-end partial match of adapters

Hi,

I have a question about Cutadapt version 0.3.

Does Cutadapt cut partial sequences of adapters?

According to "Statistics for adapter" messages, Cutadapt seems to recognize 3'-end partial match of adapters. However, only full-matched adapter sequences are removed in output files.

[mmartin]

Yes, Python 2.6 is needed, thanks for the pointer. It wouldn't be hard to support Python 2.5, but some 2.6 features make the transition to the Python 3 syntax easier, so I would like to stick to it. I have updated the homepage to reflect the requirement of Python 2.6.

[Torst]

I'm pleased to announce the tool 'cutadapt
http://cutadapt.googlecode.com/

It seems your code only runs under Python 2.6 ?

For Centos 5.x, which is a bit behind, I had to install the "python26" packages and change the #!/usr/bin/python to #!/usr/bin/python26.

[mmartin]

I'm pleased to announce the tool 'cutadapt', which we have been using in our research group for adapter removal in high-throughput sequencing data. Removing adapter sequences from reads is necessary when the read length of the sequencing machine is longer than the molecule that is sequenced, for example when sequencing small RNAs.

Since special code is included to handle color space data correctly, the tool may be especially useful for people who do not use Applied Biosystem's Corona pipeline.

cutadapt is under the MIT license.

Please see the web page for a feature list and a link to a downloadable package:

http://cutadapt.googlecode.com/