Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • agc
    Member
    • May 2010
    • 26

    unrecognized .txt format

    Hi,

    I recently received data from illumina, and I am unable to determine the file format or how to convert it to a fastq for bwa. I found lots of documentation on a format called qseq, and several conversion scripts, but it doesn't seem to be the format I'm dealing with and the scripts don't work.

    The lines in the files look like this:

    Code:
    NAME:3:1:1138:1083#0/1:ATATATGAGTGGGGTATAAACGGAGATTGATTTCGT:abababbababbbb`bbaaa]b_ab`aa]^_a_``^
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    It looks like SCARF using FASTQ style encoding for the quality scores.

    Looks like you can just split the lines on the colon, something like this (in Python) should give you a FASTQ file:

    Code:
    #!/usr/bin/env python
    """
    Simple script to generate FASTQ from colon separated SCARF input 
    where the quality scores are ASCII encoded (FASTQ like).
    
    Use at the command line, piping the input and output.
    """
    import sys
    for line in sys.stdin:
        name, seq, qual = line.rstrip("\n").rsplit(":",2)
        assert len(seq) == len(qual), line
        sys.stdout.write("@%s\n%s\n+\n%s\n" % (name, seq, qual))
    The same idea would be equally trivial in Perl or your language of choice.
    Last edited by maubp; 11-17-2010, 05:51 AM.

    Comment

    • agc
      Member
      • May 2010
      • 26

      #3
      Thanks a lot! It seems to be working. Any idea why these files are in this format? They're supposed to be illumina files.

      Comment

      • maubp
        Peter (Biopython etc)
        • Jul 2009
        • 1544

        #4
        SCARF is one of the many formats used by Solexa/Illumina, it gets confusing

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Nine Things a Sample Prep Scientist Thinks About Before Sequencing
          by SEQadmin2


          I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


          Here are nine questions we think about, in roughly the order they matter, before...
          Yesterday, 07:11 AM
        • SEQadmin2
          From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
          by SEQadmin2


          Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


          The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
          ...
          06-02-2026, 10:05 AM
        • SEQadmin2
          Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
          by SEQadmin2


          With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


          Introduction

          Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
          05-22-2026, 06:42 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 06-17-2026, 06:09 AM
        0 responses
        19 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-09-2026, 11:58 AM
        0 responses
        38 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-05-2026, 10:09 AM
        0 responses
        43 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-04-2026, 08:59 AM
        0 responses
        49 views
        0 reactions
        Last Post SEQadmin2  
        Working...