Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • agc
    Member
    • May 2010
    • 26

    unrecognized .txt format

    Hi,

    I recently received data from illumina, and I am unable to determine the file format or how to convert it to a fastq for bwa. I found lots of documentation on a format called qseq, and several conversion scripts, but it doesn't seem to be the format I'm dealing with and the scripts don't work.

    The lines in the files look like this:

    Code:
    NAME:3:1:1138:1083#0/1:ATATATGAGTGGGGTATAAACGGAGATTGATTTCGT:abababbababbbb`bbaaa]b_ab`aa]^_a_``^
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    It looks like SCARF using FASTQ style encoding for the quality scores.

    Looks like you can just split the lines on the colon, something like this (in Python) should give you a FASTQ file:

    Code:
    #!/usr/bin/env python
    """
    Simple script to generate FASTQ from colon separated SCARF input 
    where the quality scores are ASCII encoded (FASTQ like).
    
    Use at the command line, piping the input and output.
    """
    import sys
    for line in sys.stdin:
        name, seq, qual = line.rstrip("\n").rsplit(":",2)
        assert len(seq) == len(qual), line
        sys.stdout.write("@%s\n%s\n+\n%s\n" % (name, seq, qual))
    The same idea would be equally trivial in Perl or your language of choice.
    Last edited by maubp; 11-17-2010, 05:51 AM.

    Comment

    • agc
      Member
      • May 2010
      • 26

      #3
      Thanks a lot! It seems to be working. Any idea why these files are in this format? They're supposed to be illumina files.

      Comment

      • maubp
        Peter (Biopython etc)
        • Jul 2009
        • 1544

        #4
        SCARF is one of the many formats used by Solexa/Illumina, it gets confusing

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM
        • SEQadmin2
          Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
          by SEQadmin2



          Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
          ...
          07-09-2026, 11:10 AM
        • SEQadmin2
          Cancer Drug Resistance: The Lingering Barrier to Rising Survival
          by SEQadmin2



          Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

          There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
          07-08-2026, 05:17 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 07-24-2026, 12:17 PM
        0 responses
        18 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-23-2026, 11:41 AM
        0 responses
        18 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-20-2026, 11:10 AM
        0 responses
        25 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-13-2026, 10:26 AM
        0 responses
        38 views
        0 reactions
        Last Post SEQadmin2  
        Working...