Tweet
Ditto, it is a pain also for us, would be very nice to have it fixed in GATK. They say in http://getsatisfaction.com/gsa/topic...ent_i_d_events that this is a buggy CIGAR but I doubt - there is nothing to say adjacent I/Ds are forbidden. New aligners that are not based on Smith-Waterman or BW can generate valid alignments with CIGARs like this. Should we ask them again on the GATK forum to have an other look?
-
-
Stampy->GATK
Ah, OK excellent. Thanks so much, I'll give version 13 a try. Yes, I really want to be able to maintain use of stampy as the aligner- it does an excellent job with highly polymorphic alignments.Originally posted by ameynert View PostComment
-
Exact same problem
I'm using version 13 of Stampy, but have exactly the same problem when trying to call indels with -glm INDEL, namely:
"SAM/BAM file SAMFileReader{/Volumes/Data/sherlock/Pseudomonas/All_PAO1_strains.realigned.recal.bam} is malformed: Adjacent I/D events in read MAGNUM:2:65:15227:4196#0"
The reads in question have the following alignments:
MAGNUM:2:65:15227:4196#0 83 NC_002516.2 33359 5 4M4D2M11I19M = 33371 -16 TGAACCGCTCTTCTGATCTCGGCGGTGTATTCGCCG =8?8=C7HAF?AF<;2=G@G:CH:3?/,4:8A1;3: RG:Z:GSRG000011 NM:i:1 MQ:i:5 OQ:Z:=7?5A@4A@BA@B:@@7D@D@BA@BB338:86868B PQ:i:431 UQ:i:23 XQ:i:228
MAGNUM:2:65:15227:4196#0 163 NC_002516.2 33371 5 18M11I6D7M = 33359 16 CGGCGGTGTATTCGCCGAGATCGGAAGAGCGTCGTG @FGEFIBKB?DBHJGHKCID=FJJ9FB9K0KCIKCB RG:Z:GSRG000011 NM:i:1 SM:i:0 MQ:i:5 OQ:Z:IHIGFGIIIDGGGEEIIBDI@DGG8G?DG2GDGGGD PQ:i:431 UQ:i:42 XQ:i:204
The file worked fine for calling SNPs. Does anyone know a fix or workaround? Can one simply:
samtools view All_PAO1_strains.realigned.recal.bam | grep -v "MAGNUM:2:65:15227:4196#0" > fixed.sam
add in the header, index and rerun? I guess I'll try.Comment
-
Hi Gavin,
try adding -rf BadCigar and see what happens.
Let me know if it works for youComment
-
I've set it running, and it has passed the point of failure, so potentially looks good. If it fails elsewhere, I'll follow up, otherwise assume that it worked.Originally posted by NGSfan View Post
Many thanks for the help.Comment
-
Same problem--running identical pipelines on some exome data with several aligners and only got this error with the Stampy (v14) BAMs (specifically for -INDEL or -BOTH, but not with -SNPS). Will try the above--ThanksLast edited by dustinlong; 01-21-2012, 10:15 AM.Comment
-
With version GenomeAnalysisTK-1.5-32, I still have the same problem. Using the -rf BadCigar allows the UnifiedGenotyper analysis to proceed.Originally posted by dustinlong View PostComment
-
Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.07-01-2026, 11:43 AM
-
I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.
Here are nine questions we think about, in roughly the order they matter, before...
Comment