Ditto, it is a pain also for us, would be very nice to have it fixed in GATK. They say in http://getsatisfaction.com/gsa/topic...ent_i_d_events that this is a buggy CIGAR but I doubt - there is nothing to say adjacent I/Ds are forbidden. New aligners that are not based on Smith-Waterman or BW can generate valid alignments with CIGARs like this. Should we ask them again on the GATK forum to have an other look?
-
-
Stampy->GATK
Ah, OK excellent. Thanks so much, I'll give version 13 a try. Yes, I really want to be able to maintain use of stampy as the aligner- it does an excellent job with highly polymorphic alignments.Originally posted by ameynert View PostComment
-
Exact same problem
I'm using version 13 of Stampy, but have exactly the same problem when trying to call indels with -glm INDEL, namely:
"SAM/BAM file SAMFileReader{/Volumes/Data/sherlock/Pseudomonas/All_PAO1_strains.realigned.recal.bam} is malformed: Adjacent I/D events in read MAGNUM:2:65:15227:4196#0"
The reads in question have the following alignments:
MAGNUM:2:65:15227:4196#0 83 NC_002516.2 33359 5 4M4D2M11I19M = 33371 -16 TGAACCGCTCTTCTGATCTCGGCGGTGTATTCGCCG =8?8=C7HAF?AF<;2=G@G:CH:3?/,4:8A1;3: RG:Z:GSRG000011 NM:i:1 MQ:i:5 OQ:Z:=7?5A@4A@BA@B:@@7D@D@BA@BB338:86868B PQ:i:431 UQ:i:23 XQ:i:228
MAGNUM:2:65:15227:4196#0 163 NC_002516.2 33371 5 18M11I6D7M = 33359 16 CGGCGGTGTATTCGCCGAGATCGGAAGAGCGTCGTG @FGEFIBKB?DBHJGHKCID=FJJ9FB9K0KCIKCB RG:Z:GSRG000011 NM:i:1 SM:i:0 MQ:i:5 OQ:Z:IHIGFGIIIDGGGEEIIBDI@DGG8G?DG2GDGGGD PQ:i:431 UQ:i:42 XQ:i:204
The file worked fine for calling SNPs. Does anyone know a fix or workaround? Can one simply:
samtools view All_PAO1_strains.realigned.recal.bam | grep -v "MAGNUM:2:65:15227:4196#0" > fixed.sam
add in the header, index and rerun? I guess I'll try.Comment
-
Hi Gavin,
try adding -rf BadCigar and see what happens.
Let me know if it works for youComment
-
I've set it running, and it has passed the point of failure, so potentially looks good. If it fails elsewhere, I'll follow up, otherwise assume that it worked.Originally posted by NGSfan View Post
Many thanks for the help.Comment
-
Same problem--running identical pipelines on some exome data with several aligners and only got this error with the Stampy (v14) BAMs (specifically for -INDEL or -BOTH, but not with -SNPS). Will try the above--ThanksLast edited by dustinlong; 01-21-2012, 10:15 AM.Comment
-
With version GenomeAnalysisTK-1.5-32, I still have the same problem. Using the -rf BadCigar allows the UnifiedGenotyper analysis to proceed.Originally posted by dustinlong View PostComment
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...Yesterday, 11:01 AM -
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...07-20-2026, 11:48 AM -
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...07-09-2026, 11:10 AM
Comment