Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • brachysclereid
    Member
    • Feb 2011
    • 32

    #1

    Cufflinks error

    When running cufflinks I get the following error:

    $ cufflinks -G annotation.gtf ./s_1/accepted_hits.bam
    cufflinks: /usr/lib64/libz.so.1: no version information available (required by cufflinks)
    Error: sort order of reads in BAMs must be the same

    I am using TopHat v1.1.4 to create the BAMs with bowtie indexes.
    The cufflinks version is cufflinks v0.9.3.

    Based on previous posts I tried reverting from the BAM to SAM, but got the same result.

    Any ideas? Thanks!
  • jgarbe
    Member
    • Mar 2010
    • 14

    #2
    Same here

    I've run into the same issue...

    Comment

    • ameyer
      Member
      • Jan 2011
      • 23

      #3
      Me too

      I've had this error as well. I emailed the help email address and they said it's a rare issue with the software where the contig names have hash collisions. The problem should be fixed when they release Cufflinks v1.0.

      Comment

      • brachysclereid
        Member
        • Feb 2011
        • 32

        #4
        cufflinks version 1.0

        Thanks for the information. Did they mention when they would release that version?

        Comment

        • Aurelien Mazurie
          Member
          • Feb 2011
          • 15

          #5
          I had exactly the same problem; sorting the BAM file didn't help.

          Comment

          • ameyer
            Member
            • Jan 2011
            • 23

            #6
            Tech support was able to find the cause of my error in my SAM file. In the header section I had some colons as part of my contig names that messed up Cufflinks. By removing the colons in the header and throughout the file I stopped getting this error.
            Originally I had:
            @SQ SN:chromosome:AGPv2:1:1:301354135:1 LN:301354135
            and this changed to:
            @SQ SN:chromosome1 LN:301354135

            Hope this helps.
            Last edited by ameyer; 03-01-2011, 07:45 AM.

            Comment

            • Aurelien Mazurie
              Member
              • Feb 2011
              • 15

              #7
              Interesting. I checked my SAM files, and the @SQ lines only have two colons:

              @HD VN:1.0 SO:sorted
              @SQ SN:EG:bd_7x3 LN:450
              @SQ SN:EG:bd_6x3 LN:450
              @SQ SN:EG:bd_36x35 LN:554
              @SQ SN:EG:bd_55x36 LN:808
              @SQ SN:EG:bd_54x36 LN:1351
              @SQ SN:EG:bd_16x14 LN:1992
              @SQ SN:EG:bd_53x36 LN:2027
              @SQ SN:EG:bd_52x36 LN:2040
              @SQ SN:EG:bd_51x36 LN:2113
              @SQ SN:EG:bd_37x35 LN:2489
              . . .

              From your experience, is that enough to trigger the error?

              What about the reads references after that? Mine do contain a lot of colons. Did you have to modify them to? E.g.,

              @PG ID:TopHat VN:1.2.0 CL:../Applications/tophat/1.2.0/tophat -o ./2_run_TopHat/JV-
              A_on_Phatr-ENSEMBL-unmasked --num-threads 4 -G ../Data/Genome/ENSEMBL/Phaeodactylum_tricornutum.Phat
              r2.61.gtf ./1_create_Bowtie_index/Phatr-ENSEMBL-unmasked ../Data/Expression/2011.02.02/JV-A.fastq
              SNPSTER7_0744:2:33:16520:18860#0 16 EG:bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
              hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1
              SNPSTER7_0744:2:58:18789:10460#0 16 EG:bd_6x3 6 255 54M * 0 0 GGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTCG [ffffc_ccfffWcZ\Z\ZYT_NYcfaaf
              ffcfccff]fffccffffafffafc NM:i:0 NH:i:1
              . . .

              Comment

              • ameyer
                Member
                • Jan 2011
                • 23

                #8
                The only colons that are allowed in the @SQ lines are the ones directly after SN and LN so the one you have between EG and bd would have to be removed. It would also have to be removed in all the read references so that the the names match each other.
                So for example you would have:
                @SQ SN:bd_6x3 LN:450
                and:
                SNPSTER7_0744:2:33:16520:18860#0 16 bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
                hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1

                Comment

                • Aurelien Mazurie
                  Member
                  • Feb 2011
                  • 15

                  #9
                  It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                  Aurelien
                  Attached Files

                  Comment

                  • delphi_ote
                    Junior Member
                    • Oct 2010
                    • 9

                    #10
                    Originally posted by Aurelien Mazurie View Post
                    It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                    Aurelien
                    Your script just saved my bacon. Thank you SO much for this!!!

                    Comment

                    • eieneg
                      Junior Member
                      • Feb 2017
                      • 5

                      #11
                      COLONS in the fasta and GFF!!!!!

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, Today, 12:22 PM
                      0 responses
                      8 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-11-2026, 10:35 AM
                      0 responses
                      11 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-06-2026, 07:41 AM
                      0 responses
                      30 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-03-2026, 10:13 AM
                      0 responses
                      48 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...