featureCounts output format error

[slefevre]

Hi

I am trying to use the latest version of featureCounts (Subread package version 2.0.0) with the following command (based on Chothani, S. 2019. Current Protocols in Molecular Biology, 129, e108. doi: 10.1002/cpmb.108):

featureCounts -T 5 -t CDS -g gene_id -O -J -R -G /cluster/home/sjannies/blast_databases/GCF_003368295.1_ASM336829v1_genomic.fna -a /cluster/home/sjannies/blast_databases/GCF_003368295.1_ASM336829v1_genomic.gtf -o rfp_mapped_to_goldfish_genome_featureCounts.txt /cluster/work/users/sjannies/rfp/star/bams/24hR50_rfp_goldfish_Aligned.sortedByCoord.out.bam

I get the error: unknown output format: '-G'

If I remove all extra options (-O -J -R -G ) featureCounts finish succesfully.


Anyone have an idea what is wrong?

Cheers
Sjannie

Below is head of gtf file:

#gtf-version 2.2
#!genome-build ASM336829v1
#!genome-build-accession NCBI_Assembly:GCF_003368295.1
#!annotation-source NCBI Carassius auratus Annotation Release 100
NC_039243.1 Gnomon gene 5705 16574 . - . gene_id "LOC113109012"; db_xref "GeneID:113109012"; gbkey "Gene"; gene "LOC113109012"; gene_biotype "protein_coding";
NC_039243.1 Gnomon exon 16363 16574 . - . gene_id "LOC113109012"; transcript_id "XM_026272525.1"; db_xref "GeneID:113109012"; gbkey "mRNA"; gene "LOC113109012"; model_evidence "Supporting evidence includes similarity to: 8 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 74 samples with support for all annotated introns"; product "OX-2 membrane glycoprotein-like, transcript variant X1"; exon_number "1";


Output of command 'grep "CDS" /cluster/home/sjannies/blast_databases/GCF_003368295.1_ASM336829v1_genomic.gtf | head':

NC_039243.1 Gnomon CDS 16363 16512 . - 0 gene_id "LOC113109012"; transcript_id "XM_026272525.1"; db_xref "GeneID:113109012"; gbkey "CDS"; gene "LOC113109012"; product "OX-2 membrane glycoprotein-like isoform X1"; protein_id "XP_026128310.1"; exon_number "1";
NC_039243.1 Gnomon CDS 15265 15340 . - 0 gene_id "LOC113109012"; transcript_id "XM_026272525.1"; db_xref "GeneID:113109012"; gbkey "CDS"; gene "LOC113109012"; product "OX-2 membrane glycoprotein-like isoform X1"; protein_id "XP_026128310.1"; exon_number "2";


Following is head of bam file:
NB501273:265:HVMKCBGXC:3:22503:25876:14641 16 NC_039243.1 1360 255 16M1D14M * 0 0 TTAGATAAAACTTCTGCGCTTAACAGATCT EEAE/A/A//EEEEEEE6AEEEE/EAA/66 NH:i:1 HI:i:1 AS:i:25 nM:i:0 NM:i:1 MD:Z:16^C14 jM:B:c,-1 jI:B:i,-1
NB501273:265:HVMKCBGXC:3:21606:21604:16716 272 NC_039243.1 6218 1 30M * 0 0 CTTCAGGCAGATACACAGACATACGAGCAG EEEEEEEEEEEEEEEEEEEEEEEEEAAAAA NH:i:4 HI:i:2 AS:i:29 nM:i:0 NM:i:0 MD:Z:30 jM:B:c,-1 jI:B:i,-1

[abedkurdi]

Hello slefevre,
your problem here is with `-R` option. You have to specify which format to use: CORE, SAM or BAM.
So it is failing because you are missing the format and it is considering `-G` as input for `-R`, that's why it is failing.