Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • abubd
    Junior Member
    • Oct 2021
    • 2

    mapping with bbmap anderror

    I am having a problem when mapping my short reads 150bp (paired-end reads) to the genome fasta.

    I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.

    Here I face the problem: I assigned 20 threads (20 cores) but my job ended up with error. Why it is happening and what is the solution?. Each file 23 GB big (R1 and R2)

    Code:
    job starting at 09:42:42
    java -ea -Xmx60001m -Xms60001m -cp /sw/bioinfo/bbmap/38.61b/rackham/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 pairedonly=t ambiguous=toss killbadpairs=t pairlen=1000 trimq=20 mintrimlength=120 minaveragequality=20 rescuemismatches=1 outm=2008-27-201.aligned.sam outu=2008-27-201.unaligned.sam showprogress=10000 scafstats=2008_27.scafstats in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz threads=auto
    Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, pairedonly=t, ambiguous=toss, killbadpairs=t, pairlen=1000, trimq=20, mintrimlength=120, minaveragequality=20, rescuemismatches=1, outm=2008-27-201.aligned.sam, outu=2008-27-201.unaligned.sam, showprogress=10000, scafstats=2008_27.scafstats, in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz, in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz, threads=auto]
    Version 38.61
    
    Scaffold statistics will be written to 2008_27.scafstats
    Set threads to 20
    Ambiguously mapped reads will be considered unmapped.
    Set genome to 1
    
    Loaded Reference:       2.025 seconds.
    Loading index for chunk 1-1, build 1
    Generated Index:        3.261 seconds.
    Analyzed Index:         2.517 seconds.
    Started output stream:  0.371 seconds.
    Started output stream:  0.023 seconds.
    Creating scaffold statistics table:     0.065 seconds.
    Cleared Memory:         0.516 seconds.
    Processing reads in paired-ended mode.
    Started read stream.
    Started 20 mapping threads.
    Exception in thread "Thread-6" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:13711:1783 1:N:0:TAATGCGC+AGGCGAAG  0       -1      +       -1      -1      00000000000000000000000 1       0       0       ATGTTGAATATGCTTTGTTTTATGTTATAATCAGGTGCTATTTAATTGTTTGACTGTTGGTGATTGCAGGTTTTGGAGAAAAGGAGGAGCTCATCCAGATCAACAAAGCTTGGACTTCTACAACAGCGTTTGGACAAAGGTAAGAACGAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .
            at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
            at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
            at align2.AbstractMapThread.run(AbstractMapThread.java:536)
    Detecting finished threads: 0Exception in thread "Thread-18" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:16107:1705 2:N:0:TAATGCGC+AGGCGAAG    601     -1      +       -1      -1      00000000001000000000000 1       0       0       CCGACCCTCCAAGAGTGTCTGGTATGTGTGGCTGAATTCTGGGTCGCTTTTGTAGAGAAGTGGCCAATCAGAAGTCTCGTGCCCGCAAGAGTTGAGCACGGTGGTTAGCGCCATGATCGGTGGTCGACTGAGGCAATCTGCAACATTATTG FFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FF,FFF .       .       .       .       1,1,28300816,28300966,0,00,14,14532,14556,14557,145561,1,28300816,28300966,0,00,14,14532,14556,14557,14556
            at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
            at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
            at align2.AbstractMapThread.run(AbstractMapThread.java:536)
    Exception in thread "Thread-24" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:8558:1626 1:N:0:TAATGCGC+AGGCGAAG  1002    -1      +       -1      -1      00000000000000000000000 1       0       0       GAAAACGGCTCCCACTTATTCTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCTGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTAGATAGTAGATAGGGACAGTGGGAA FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFF .       .       .       .       1,0,14943298,14943448,0,00,10,11843,11823,15526,118231,0,14943298,14943448,0,00,10,11843,11823,15526,11823      1,0,15184887,15185037,0,00,11,11685,11645,11646,116451,0,15184887,15185037,0,00,11,11685,11645,11646,11645
            at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
            at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
            at align2.AbstractMapThread.run(AbstractMapThread.java:536)
    Exception in thread "Thread-14" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:2293:1016 2:N:0:TAATGCGC+AGGCGAAG  1404    -1      +       -1      -1      00000000001000000000000 1       0       0       NATAGAGACAAGCTTTTATAGATAGAGAGGAAAGAGATAGGATCAACCACAATATTCATGGGATTGGCTTTATCACTTAGAAACTTCCATGAAAGGTGGCAAACCACTTCCCTTCTATGGAGATTCG !FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .       1,0,37647506,37647634,0,00,6,7881,8211,0,82111,0,37647506,37647634,0,00,6,7881,8211,0,8211
            at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
            at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
            at align2.AbstractMapThread.run(AbstractMapThread.java:536)
    Exception in thread "Thread-8" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:3766:2785 2:N:0:TAATGCGC+AGGCGAAG   3802    -1      +       -1      -1      00000000001000000000000 1       0       0       GCAATGGATCGGTAGCATTACCCCAAATATGGATGGTATGGAGAGACCATGGTG  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF  .       .       .       .       1,0,21465899,21466010,0,00,1,1003,0,0,01,0,21465899,21466010,0,00,1,1003,0,0,0  1,0,27814628,27814681,0,00,4,4856,4856,4857,48561,0,27814628,27814681,0,00,4,4856,4856,4857,4856
            at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
    
    
    -------------------
    ---------------------
    -----------------------------
    
    
    , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
    
    **************************************************************************
    Warning!  20 mapping threads did not terminate normally.
    Check the error log; the output may be corrupt or incomplete.
    Please submit the full stderr output as a bug report, not just this message.
    **************************************************************************
    
    
       ------------------   Results   ------------------
    
    Genome:                 1
    Key Length:             13
    Max Indel:              16000
    Minimum Score Ratio:    0.56
    Mapping Mode:           normal
    Reads Used:             212     (28878 bases)
    
    Mapping:                0.669 seconds.
    Reads/sec:              316.77
    kBases/sec:             43.15
    
    
    Pairing data:           pct pairs       num pairs       pct bases          num bases
    
    mated pairs:              2.8302%               3         1.9600%                566
    bad pairs:                0.0000%               0         0.0000%                  0
    insert size avg:           97.67
    
    
    Read 1 data:            pct reads       num reads       pct bases          num bases
    
    mapped:                   2.8302%               3         1.9552%                283
    unambiguous:              2.8302%               3         1.9552%                283
    ambiguous:                0.0000%               0         0.0000%                  0
    low-Q discards:           0.9434%               1         1.0432%                151
    
    perfect best site:        0.0000%               0         0.0000%                  0
    semiperfect site:         0.0000%               0         0.0000%                  0
    rescued:                  0.0000%               0
    
    Match Rate:                   NA               NA        86.9258%                246
    Error Rate:             100.0000%               3         9.1873%                 26
    Sub Rate:               100.0000%               3         9.1873%                 26
    Del Rate:                 0.0000%               0         0.0000%                  0
    Ins Rate:                 0.0000%               0         0.0000%                  0
    N Rate:                  33.3333%               1         3.8869%                 11
    
    
    Read 2 data:            pct reads       num reads       pct bases          num bases
    
    mapped:                   2.8302%               3         1.9647%                283
    unambiguous:              2.8302%               3         1.9647%                283
    ambiguous:                0.0000%               0         0.0000%                  0
    low-Q discards:           1.8868%               2         1.8189%                262
    
    perfect best site:        0.0000%               0         0.0000%                  0
    semiperfect site:         0.0000%               0         0.0000%                  0
    rescued:                  0.0000%               0
    
    Match Rate:                   NA               NA        89.0459%                252
    Error Rate:             100.0000%               3         9.5406%                 27
    Sub Rate:               100.0000%               3         9.5406%                 27
    Del Rate:                 0.0000%               0         0.0000%                  0
    Ins Rate:                 0.0000%               0         0.0000%                  0
    N Rate:                  33.3333%               1         1.4134%                  4
    Exception in thread "main" java.lang.AssertionError:
    The number of reads out does not add up to the number of reads in.
    This may indicate that a mapping thread crashed.
    If you submit a bug report, include the entire console output, not just this error message.
    3+0+0+82+1+0 = 86 != 106
            at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1961)
            at align2.AbstractMapper.printOutput(AbstractMapper.java:1059)
            at align2.BBMap.testSpeed(BBMap.java:522)
            at align2.BBMap.main(BBMap.java:35)
    job finishing at 09:42:59
    Last edited by abubd; 10-25-2021, 12:54 AM.
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Do you have 20 cores available on the machine for BBMap to use. What happens if you assign fewer cores? Starting with 8 would be a good number.

    Comment

    • abubd
      Junior Member
      • Oct 2021
      • 2

      #3
      Yes, cores are available as I did run it in a computer cluster. That is not a problem I think.

      Latest update: When I changed
      rescuemismatches 1 to 2
      . It started working but for a long time, 2 hours and the job is canceled due to the time limit that means I need more time to assign for this run with 20 cores (1 node). so far resulting files are:
      22G Oct 25 13:42 2008-27-201.aligned.sam
      120G Oct 25 13:42 2008-27-201.unaligned.sam
      But I want a unique reads that should not be so much!

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.
        If you need full length perfect alignments in your final file then I suggest that you try "perfectmode=t minid=1 mappedonly=t" options. If your reads are longer than 150 bp then you may need to modulate minid parameter. Add secondary=t if you want secondary alignments.

        Comment

        • yangkuki
          Junior Member
          • May 2022
          • 1

          #5
          I'm doing some research on this as well, but found little information

          Comment

          Latest Articles

          Collapse

          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM
          • SEQadmin2
            Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by SEQadmin2


            I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

            Here are nine questions we think about, in roughly the order they matter, before...
            06-18-2026, 07:11 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-02-2026, 11:08 AM
          0 responses
          7 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-30-2026, 05:37 AM
          0 responses
          12 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-26-2026, 11:10 AM
          0 responses
          20 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-17-2026, 06:09 AM
          0 responses
          54 views
          0 reactions
          Last Post SEQadmin2  
          Working...