mapping with bbmap anderror

[abubd]

I am having a problem when mapping my short reads 150bp (paired-end reads) to the genome fasta.

I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.

Here I face the problem: I assigned 20 threads (20 cores) but my job ended up with error. Why it is happening and what is the solution?. Each file 23 GB big (R1 and R2)

job starting at 09:42:42
java -ea -Xmx60001m -Xms60001m -cp /sw/bioinfo/bbmap/38.61b/rackham/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 pairedonly=t ambiguous=toss killbadpairs=t pairlen=1000 trimq=20 mintrimlength=120 minaveragequality=20 rescuemismatches=1 outm=2008-27-201.aligned.sam outu=2008-27-201.unaligned.sam showprogress=10000 scafstats=2008_27.scafstats in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz threads=auto
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, pairedonly=t, ambiguous=toss, killbadpairs=t, pairlen=1000, trimq=20, mintrimlength=120, minaveragequality=20, rescuemismatches=1, outm=2008-27-201.aligned.sam, outu=2008-27-201.unaligned.sam, showprogress=10000, scafstats=2008_27.scafstats, in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz, in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz, threads=auto]
Version 38.61

Scaffold statistics will be written to 2008_27.scafstats
Set threads to 20
Ambiguously mapped reads will be considered unmapped.
Set genome to 1

Loaded Reference:       2.025 seconds.
Loading index for chunk 1-1, build 1
Generated Index:        3.261 seconds.
Analyzed Index:         2.517 seconds.
Started output stream:  0.371 seconds.
Started output stream:  0.023 seconds.
Creating scaffold statistics table:     0.065 seconds.
Cleared Memory:         0.516 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 20 mapping threads.
Exception in thread "Thread-6" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:13711:1783 1:N:0:TAATGCGC+AGGCGAAG  0       -1      +       -1      -1      00000000000000000000000 1       0       0       ATGTTGAATATGCTTTGTTTTATGTTATAATCAGGTGCTATTTAATTGTTTGACTGTTGGTGATTGCAGGTTTTGGAGAAAAGGAGGAGCTCATCCAGATCAACAAAGCTTGGACTTCTACAACAGCGTTTGGACAAAGGTAAGAACGAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Detecting finished threads: 0Exception in thread "Thread-18" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:16107:1705 2:N:0:TAATGCGC+AGGCGAAG    601     -1      +       -1      -1      00000000001000000000000 1       0       0       CCGACCCTCCAAGAGTGTCTGGTATGTGTGGCTGAATTCTGGGTCGCTTTTGTAGAGAAGTGGCCAATCAGAAGTCTCGTGCCCGCAAGAGTTGAGCACGGTGGTTAGCGCCATGATCGGTGGTCGACTGAGGCAATCTGCAACATTATTG FFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FF,FFF .       .       .       .       1,1,28300816,28300966,0,00,14,14532,14556,14557,145561,1,28300816,28300966,0,00,14,14532,14556,14557,14556
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-24" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:8558:1626 1:N:0:TAATGCGC+AGGCGAAG  1002    -1      +       -1      -1      00000000000000000000000 1       0       0       GAAAACGGCTCCCACTTATTCTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCTGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTAGATAGTAGATAGGGACAGTGGGAA FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFF .       .       .       .       1,0,14943298,14943448,0,00,10,11843,11823,15526,118231,0,14943298,14943448,0,00,10,11843,11823,15526,11823      1,0,15184887,15185037,0,00,11,11685,11645,11646,116451,0,15184887,15185037,0,00,11,11685,11645,11646,11645
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-14" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:2293:1016 2:N:0:TAATGCGC+AGGCGAAG  1404    -1      +       -1      -1      00000000001000000000000 1       0       0       NATAGAGACAAGCTTTTATAGATAGAGAGGAAAGAGATAGGATCAACCACAATATTCATGGGATTGGCTTTATCACTTAGAAACTTCCATGAAAGGTGGCAAACCACTTCCCTTCTATGGAGATTCG !FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .       1,0,37647506,37647634,0,00,6,7881,8211,0,82111,0,37647506,37647634,0,00,6,7881,8211,0,8211
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-8" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:3766:2785 2:N:0:TAATGCGC+AGGCGAAG   3802    -1      +       -1      -1      00000000001000000000000 1       0       0       GCAATGGATCGGTAGCATTACCCCAAATATGGATGGTATGGAGAGACCATGGTG  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF  .       .       .       .       1,0,21465899,21466010,0,00,1,1003,0,0,01,0,21465899,21466010,0,00,1,1003,0,0,0  1,0,27814628,27814681,0,00,4,4856,4856,4857,48561,0,27814628,27814681,0,00,4,4856,4856,4857,4856
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)


-------------------
---------------------
-----------------------------


, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19

**************************************************************************
Warning!  20 mapping threads did not terminate normally.
Check the error log; the output may be corrupt or incomplete.
Please submit the full stderr output as a bug report, not just this message.
**************************************************************************


   ------------------   Results   ------------------

Genome:                 1
Key Length:             13
Max Indel:              16000
Minimum Score Ratio:    0.56
Mapping Mode:           normal
Reads Used:             212     (28878 bases)

Mapping:                0.669 seconds.
Reads/sec:              316.77
kBases/sec:             43.15


Pairing data:           pct pairs       num pairs       pct bases          num bases

mated pairs:              2.8302%               3         1.9600%                566
bad pairs:                0.0000%               0         0.0000%                  0
insert size avg:           97.67


Read 1 data:            pct reads       num reads       pct bases          num bases

mapped:                   2.8302%               3         1.9552%                283
unambiguous:              2.8302%               3         1.9552%                283
ambiguous:                0.0000%               0         0.0000%                  0
low-Q discards:           0.9434%               1         1.0432%                151

perfect best site:        0.0000%               0         0.0000%                  0
semiperfect site:         0.0000%               0         0.0000%                  0
rescued:                  0.0000%               0

Match Rate:                   NA               NA        86.9258%                246
Error Rate:             100.0000%               3         9.1873%                 26
Sub Rate:               100.0000%               3         9.1873%                 26
Del Rate:                 0.0000%               0         0.0000%                  0
Ins Rate:                 0.0000%               0         0.0000%                  0
N Rate:                  33.3333%               1         3.8869%                 11


Read 2 data:            pct reads       num reads       pct bases          num bases

mapped:                   2.8302%               3         1.9647%                283
unambiguous:              2.8302%               3         1.9647%                283
ambiguous:                0.0000%               0         0.0000%                  0
low-Q discards:           1.8868%               2         1.8189%                262

perfect best site:        0.0000%               0         0.0000%                  0
semiperfect site:         0.0000%               0         0.0000%                  0
rescued:                  0.0000%               0

Match Rate:                   NA               NA        89.0459%                252
Error Rate:             100.0000%               3         9.5406%                 27
Sub Rate:               100.0000%               3         9.5406%                 27
Del Rate:                 0.0000%               0         0.0000%                  0
Ins Rate:                 0.0000%               0         0.0000%                  0
N Rate:                  33.3333%               1         1.4134%                  4
Exception in thread "main" java.lang.AssertionError:
The number of reads out does not add up to the number of reads in.
This may indicate that a mapping thread crashed.
If you submit a bug report, include the entire console output, not just this error message.
3+0+0+82+1+0 = 86 != 106
        at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1961)
        at align2.AbstractMapper.printOutput(AbstractMapper.java:1059)
        at align2.BBMap.testSpeed(BBMap.java:522)
        at align2.BBMap.main(BBMap.java:35)
job finishing at 09:42:59

[GenoMax]

Do you have 20 cores available on the machine for BBMap to use. What happens if you assign fewer cores? Starting with 8 would be a good number.

[abubd]

Yes, cores are available as I did run it in a computer cluster. That is not a problem I think.

Latest update: When I changed

rescuemismatches 1 to 2

. It started working but for a long time, 2 hours and the job is canceled due to the time limit that means I need more time to assign for this run with 20 cores (1 node). so far resulting files are:

22G Oct 25 13:42 2008-27-201.aligned.sam
120G Oct 25 13:42 2008-27-201.unaligned.sam

But I want a unique reads that should not be so much!

[GenoMax]

I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.

If you need full length perfect alignments in your final file then I suggest that you try "perfectmode=t minid=1 mappedonly=t" options. If your reads are longer than 150 bp then you may need to modulate minid parameter. Add secondary=t if you want secondary alignments.

[yangkuki]

I'm doing some research on this as well, but found little information