I am having a problem when mapping my short reads 150bp (paired-end reads) to the genome fasta.
I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.
Here I face the problem: I assigned 20 threads (20 cores) but my job ended up with error. Why it is happening and what is the solution?. Each file 23 GB big (R1 and R2)
I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.
Here I face the problem: I assigned 20 threads (20 cores) but my job ended up with error. Why it is happening and what is the solution?. Each file 23 GB big (R1 and R2)
Code:
job starting at 09:42:42 java -ea -Xmx60001m -Xms60001m -cp /sw/bioinfo/bbmap/38.61b/rackham/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 pairedonly=t ambiguous=toss killbadpairs=t pairlen=1000 trimq=20 mintrimlength=120 minaveragequality=20 rescuemismatches=1 outm=2008-27-201.aligned.sam outu=2008-27-201.unaligned.sam showprogress=10000 scafstats=2008_27.scafstats in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz threads=auto Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, pairedonly=t, ambiguous=toss, killbadpairs=t, pairlen=1000, trimq=20, mintrimlength=120, minaveragequality=20, rescuemismatches=1, outm=2008-27-201.aligned.sam, outu=2008-27-201.unaligned.sam, showprogress=10000, scafstats=2008_27.scafstats, in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz, in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz, threads=auto] Version 38.61 Scaffold statistics will be written to 2008_27.scafstats Set threads to 20 Ambiguously mapped reads will be considered unmapped. Set genome to 1 Loaded Reference: 2.025 seconds. Loading index for chunk 1-1, build 1 Generated Index: 3.261 seconds. Analyzed Index: 2.517 seconds. Started output stream: 0.371 seconds. Started output stream: 0.023 seconds. Creating scaffold statistics table: 0.065 seconds. Cleared Memory: 0.516 seconds. Processing reads in paired-ended mode. Started read stream. Started 20 mapping threads. Exception in thread "Thread-6" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:13711:1783 1:N:0:TAATGCGC+AGGCGAAG 0 -1 + -1 -1 00000000000000000000000 1 0 0 ATGTTGAATATGCTTTGTTTTATGTTATAATCAGGTGCTATTTAATTGTTTGACTGTTGGTGATTGCAGGTTTTGGAGAAAAGGAGGAGCTCATCCAGATCAACAAAGCTTGGACTTCTACAACAGCGTTTGGACAAAGGTAAGAACGAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF . . . . at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1097) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Detecting finished threads: 0Exception in thread "Thread-18" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:16107:1705 2:N:0:TAATGCGC+AGGCGAAG 601 -1 + -1 -1 00000000001000000000000 1 0 0 CCGACCCTCCAAGAGTGTCTGGTATGTGTGGCTGAATTCTGGGTCGCTTTTGTAGAGAAGTGGCCAATCAGAAGTCTCGTGCCCGCAAGAGTTGAGCACGGTGGTTAGCGCCATGATCGGTGGTCGACTGAGGCAATCTGCAACATTATTG FFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FF,FFF . . . . 1,1,28300816,28300966,0,00,14,14532,14556,14557,145561,1,28300816,28300966,0,00,14,14532,14556,14557,14556 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1090) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Exception in thread "Thread-24" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:8558:1626 1:N:0:TAATGCGC+AGGCGAAG 1002 -1 + -1 -1 00000000000000000000000 1 0 0 GAAAACGGCTCCCACTTATTCTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCTGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTAGATAGTAGATAGGGACAGTGGGAA FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFF . . . . 1,0,14943298,14943448,0,00,10,11843,11823,15526,118231,0,14943298,14943448,0,00,10,11843,11823,15526,11823 1,0,15184887,15185037,0,00,11,11685,11645,11646,116451,0,15184887,15185037,0,00,11,11685,11645,11646,11645 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1097) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Exception in thread "Thread-14" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:2293:1016 2:N:0:TAATGCGC+AGGCGAAG 1404 -1 + -1 -1 00000000001000000000000 1 0 0 NATAGAGACAAGCTTTTATAGATAGAGAGGAAAGAGATAGGATCAACCACAATATTCATGGGATTGGCTTTATCACTTAGAAACTTCCATGAAAGGTGGCAAACCACTTCCCTTCTATGGAGATTCG !FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF . . . . 1,0,37647506,37647634,0,00,6,7881,8211,0,82111,0,37647506,37647634,0,00,6,7881,8211,0,8211 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) at align2.BBMapThread.processReadPair(BBMapThread.java:1090) at align2.AbstractMapThread.run(AbstractMapThread.java:536) Exception in thread "Thread-8" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:3766:2785 2:N:0:TAATGCGC+AGGCGAAG 3802 -1 + -1 -1 00000000001000000000000 1 0 0 GCAATGGATCGGTAGCATTACCCCAAATATGGATGGTATGGAGAGACCATGGTG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF . . . . 1,0,21465899,21466010,0,00,1,1003,0,0,01,0,21465899,21466010,0,00,1,1003,0,0,0 1,0,27814628,27814681,0,00,4,4856,4856,4857,48561,0,27814628,27814681,0,00,4,4856,4856,4857,4856 at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200) ------------------- --------------------- ----------------------------- , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 ************************************************************************** Warning! 20 mapping threads did not terminate normally. Check the error log; the output may be corrupt or incomplete. Please submit the full stderr output as a bug report, not just this message. ************************************************************************** ------------------ Results ------------------ Genome: 1 Key Length: 13 Max Indel: 16000 Minimum Score Ratio: 0.56 Mapping Mode: normal Reads Used: 212 (28878 bases) Mapping: 0.669 seconds. Reads/sec: 316.77 kBases/sec: 43.15 Pairing data: pct pairs num pairs pct bases num bases mated pairs: 2.8302% 3 1.9600% 566 bad pairs: 0.0000% 0 0.0000% 0 insert size avg: 97.67 Read 1 data: pct reads num reads pct bases num bases mapped: 2.8302% 3 1.9552% 283 unambiguous: 2.8302% 3 1.9552% 283 ambiguous: 0.0000% 0 0.0000% 0 low-Q discards: 0.9434% 1 1.0432% 151 perfect best site: 0.0000% 0 0.0000% 0 semiperfect site: 0.0000% 0 0.0000% 0 rescued: 0.0000% 0 Match Rate: NA NA 86.9258% 246 Error Rate: 100.0000% 3 9.1873% 26 Sub Rate: 100.0000% 3 9.1873% 26 Del Rate: 0.0000% 0 0.0000% 0 Ins Rate: 0.0000% 0 0.0000% 0 N Rate: 33.3333% 1 3.8869% 11 Read 2 data: pct reads num reads pct bases num bases mapped: 2.8302% 3 1.9647% 283 unambiguous: 2.8302% 3 1.9647% 283 ambiguous: 0.0000% 0 0.0000% 0 low-Q discards: 1.8868% 2 1.8189% 262 perfect best site: 0.0000% 0 0.0000% 0 semiperfect site: 0.0000% 0 0.0000% 0 rescued: 0.0000% 0 Match Rate: NA NA 89.0459% 252 Error Rate: 100.0000% 3 9.5406% 27 Sub Rate: 100.0000% 3 9.5406% 27 Del Rate: 0.0000% 0 0.0000% 0 Ins Rate: 0.0000% 0 0.0000% 0 N Rate: 33.3333% 1 1.4134% 4 Exception in thread "main" java.lang.AssertionError: The number of reads out does not add up to the number of reads in. This may indicate that a mapping thread crashed. If you submit a bug report, include the entire console output, not just this error message. 3+0+0+82+1+0 = 86 != 106 at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1961) at align2.AbstractMapper.printOutput(AbstractMapper.java:1059) at align2.BBMap.testSpeed(BBMap.java:522) at align2.BBMap.main(BBMap.java:35) job finishing at 09:42:59
Comment