Tweet
Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?
Code:
$ head -6 clc_trim_pair4.fq
-
-
This is what I get:Originally posted by GenoMax View Post
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name
TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTCComment
-
Is that all the sequence in the file? Just one record?
If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.
Post output of.
Code:$ ls -lh clc_trim_pair4.fq
Comment
-
Hi all,
I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.Comment
-
bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.Comment
-
Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.Comment
-
I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so
Code:$ bowtie2 -help
Comment
-
Got it, thank you!Comment
-
error message: bowtie2 installation on mac
Hello, I'm not familiar to informatics and I try to install Bowtie2 on mac. I download bowtie2 source file.zip
I unzip it then when I did 'make' I have this error message:
1 error generated.
In file included from aligner_swsse_ee_u8.cpp:56:
In file included from ./aligner_sw.h:73:
./sse_wrap.h:31:10: fatal error: 'simde/x86/sse2.h' file not found
#include "simde/x86/sse2.h"
Could you help me.
Thank youComment
-
Download pre-compiled binary for macOS from here.
Consider using "conda" to install these programs that will save you a lot of time/headache.Comment
-
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...Today, 11:10 AM -
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...Yesterday, 05:17 AM -
Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.07-01-2026, 11:43 AM
Comment