Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #166
    Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

    Code:
    $ head -6 clc_trim_pair4.fq

    Comment

    • kaps
      Member
      • Jan 2015
      • 71

      #167
      Originally posted by GenoMax View Post
      Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

      Code:
      $ head -6 clc_trim_pair4.fq
      This is what I get:
      @No_name
      CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
      +
      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
      @No_name
      TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTC

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #168
        Is that all the sequence in the file? Just one record?

        If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.

        Post output of.

        Code:
        $ ls -lh clc_trim_pair4.fq

        Comment

        • sandia
          Junior Member
          • Jun 2015
          • 3

          #169
          Hi all,
          I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
          I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142

            #170
            bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.

            Comment

            • sandia
              Junior Member
              • Jun 2015
              • 3

              #171
              Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.

              Comment

              • GenoMax
                Senior Member
                • Feb 2008
                • 7142

                #172
                I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so

                Code:
                $ bowtie2 -help

                Comment

                • sandia
                  Junior Member
                  • Jun 2015
                  • 3

                  #173
                  Got it, thank you!

                  Comment

                  • delphin
                    Junior Member
                    • Jul 2021
                    • 1

                    #174
                    error message: bowtie2 installation on mac

                    Hello, I'm not familiar to informatics and I try to install Bowtie2 on mac. I download bowtie2 source file.zip
                    I unzip it then when I did 'make' I have this error message:

                    1 error generated.
                    In file included from aligner_swsse_ee_u8.cpp:56:
                    In file included from ./aligner_sw.h:73:
                    ./sse_wrap.h:31:10: fatal error: 'simde/x86/sse2.h' file not found
                    #include "simde/x86/sse2.h"

                    Could you help me.

                    Thank you

                    Comment

                    • GenoMax
                      Senior Member
                      • Feb 2008
                      • 7142

                      #175
                      Download pre-compiled binary for macOS from here.

                      Consider using "conda" to install these programs that will save you a lot of time/headache.

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM
                      • SEQadmin2
                        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                        by SEQadmin2



                        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                        ...
                        07-09-2026, 11:10 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, Yesterday, 07:41 AM
                      0 responses
                      12 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-03-2026, 10:13 AM
                      0 responses
                      25 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-31-2026, 02:55 AM
                      0 responses
                      38 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-24-2026, 12:17 PM
                      0 responses
                      25 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...