We've updated the look and feel of SEQanswers and would love feedback from you. Just reply here - we want to hear your opinions!
-
Last edited by scienceguy; 05-26-2022, 03:03 PM. -
Compute Count2(CATGCCATTCGCATTGTCCCAGTGA, CCC). -
It looks really better! Good work!Comment
-
Hello Sequencers!Comment
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment