sff_extract with titanium linker

[nathanhaigh]

Hi Aarthi,

454 inserts - Please see the blue box on the 2nd page of the following 454 flyer for a diagrammatic explanation of what inserts are and how the sequences are generated and where the linker/adaptor might be positioned anywhere in the sequence (or in fact, nowhere):
http://454.com/downloads/De-Novo-Com...omes-Flyer.pdf

Standard 454 protocols can generate 3kb, 8kb, 20kb paired end libraries. Essentially you have the linker/adapter flanked by some of the DNA from your organism that was approx 3kb, 8kb or 20kb apart in your original organism.

MIRA's sff_extract will take care of reorientating the sequences to a more standard format expected by most assembly software.

The default format for 454 pairs are as you describe and MIRA will take care of this. If sff_extract didn't find the linker/adaptor sequence in a read, it will treat it as a single end (shotgun) read without a pair i.e. maximise the usage of raw data.

The sff_extract (v0.2.8) command I use for creating a FASTQ file from the SFF file from a 20kb paired end library is as follows:
sff_extract -Q -c -l 454_titanium_linker.fasta -i “insert_size:20000,insert_stdev:5000” sff_file.sff

Hope this helps.
Nathan

[aarthi.talla]

Hello,

I will be using MIRA too for performing 454 assembly.
I would be glad if you could answer to my questions.

I am confused about what an Insert actually is ? And what is an insert size ?
I am dealing with 454 paired end data. How is a Linker different from an Adaptor?

I will be using MIRA's sff extract to extract the fasta and qual files from the sff files.
So does the sff files have read info this way:

|-----75----|------------------------100-----------------|-----75-----|

i.e - Seq.forward - Linker - Seq.reverse ??

In the above, what is an insert ? and whats the size ?
So do each of the reads in an sff have the above format ?

So in the MIRA's mates.file setup to perform scaffolding, can I just use the following default format for the mate pairs ?

pair (.*)\.f (.*)\.r

Please help me out with my confusions:

Thanks

Aarthi

[nathanhaigh]

Apologies for replying to my own thread, but I thought it'd help with future replies and archiving purposes.

According to section 5.5.4.3 Extracting paired-end data from SFF (pg 82-83) of the "Sequence assembly with MIRA3 - The Definative Guide":

The paired-end protocol of 454 will generate reads which contain the forward and reverse direction in one read, separated by a
linker. You have to know the linker sequence! Ask your sequencing provider to give it to you. If standard protocols were used,
then the linker sequence for GS20 and FLX will be
>flxlinker
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
while for Titanium data, you need to use two linker sequences
>titlinker1
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>titlinker2
CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA

So I guess I do need the reverse complement of the titanium linker after all.

[nathanhaigh]

A quick question...

I have some sff files from a paired end 454 run using the titanium linker. When I extract the fastq data from the sff files using:
sff_extract.py -Q -l linker.fasta *.sff

Do I need to include the reverse compliment in the linker.fasta file like:
>titanium_linker_seq
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>titanium_linker_seq_rc
CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA

I'm using sff_extract 0.2.8

Cheers,
Nathan