problems when using the software Phrap and consed

[dingkai0564]

when I use consed to display ace file generated by phrap one error happens:

The error is :

exception thrown: ace file error detected from source file parseAceFile.cpp at 2368
Error in file 34-9EST.out.ace at line 1736. Line:


premature end of file while expecting DS line for read

ace file: 34-9EST.out.ace
Version 20.0 (101012)
ace file error detected from source file parseAceFile.cpp at 2368
Error in file 34-9EST.out.ace at line 1736. Line:


premature end of file while expecting DS line for read
ace file = 34-9EST.out.ace

Does anyone know how to solve this problems? thanks !

my sequence file is a multiple fasta file, I used this command to generate the ace file:

for the multifasta file, I did not use the phred to generate it. the detail format is like:

>109823783

GATCCATCACTTCTACCAGCTTCATCATGCAATAAAACTGTAAGAATCCCTGCACTACCTGCGGCAACAAATGCTCAAAGCAGACTTTACAATGAATATGCTGCAGTATATCTTCTCATCGCTTCTTCATTGACCATGATTATACTCTAGTTCGAGGCTGATTCAGTCTTTTCTCCAGAACTGTATGACATAAGATCAGTCTTCTTAAGGACAAATGGATGAAATCCTCTCAAGTTTAACACTGATTCAGGCATGACCACCTGTTAATGGAATGTTCAACCAGATGCAGACTCAAGTCCATGTATCTGATCATATAACGATTCTTGCATGTTTTCTGTAATAATATTTTTGTAAAAAAAGGCTACTTGGGT

>84174260

TCTTCCTCCTCTAGTTTTTCACGTTCCCAAACTCTCCTAACGTCTTAACCATTCTCCTAATCTCTTTTCCATTTTTGGCTTCCTTTAAGCTTTCTTTCCAACCTTACTTGTATTACTAAGTGAAAGAAGAAGATTATGAGTGCAGGCGTGTCTCTCCTCACTATGCTATTCCTTGAGTTGTTTATGCTTTTCGCCTGCTTCCATGAATGTTTATCCAGCCCTGTGGATCAACTTAAAAGTTATATCTTAACACAAAG



./phrap 34-9EST.out -new_ace > 34-9test.out

[sklages]

This problem has been "discussed" on the consed mailing list with you ... have you solved the problem or have you switched to MIRA?

Sven

[dingkai0564]

Yes, I am trying to use mira to do my work! thanks for your good advice.

The reason why I want to post here is that I still want to solve the problem because it is still there.

But I think MIRA can do a very good similar job.