Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Inosine in B-adaptor of Rapid Library

    Example for RL13

    A:
    FAM/ CCATCTCATCCCTGCGTGTCTCCGACGACTAGACTCGACGT
    Bold = key, followed by MID


    B:

    5Phos/CGTCGIGTCTIGTCGICG TCTCTCAAGGCACACAGGGGATAGG

    Does anyone have an idea on why the inosines are used in the Y-adaptors?

  • #2
    My guess:

    Y-adaptors of this sort would require an MID sequence that is complementary to the proximal end of the B adaptor.

    Inosines should base pair promiscuously. So, by including those inosines, you allow the desired Y-adapter annealing to form, even across the MID sequence.

    But also you allow the true B-primer to anneal and amplify on the other end of the amplicon during emPCR.

    --
    Phillip

    Comment


    • #3
      My guess is that using inosines to prevent supressive PCR.

      Inosines allow forming of Y adaptors initially, but after the sencond cycle of amplification, it's sequence on the newly formed strand would be changed, such that it prevents formation of a haipin struction.

      Incidently, I once designed a Y adaptor with a stem of lenght 17 bp (of course without inosines), which completely inhibit PCR amplification. From the sequences you provided above, I see that there is an 18bp stem. If inosines were not used, amplification would not work.

      Later, I designed a set of new Y adaptors with stems of only 10 bp, which allows formation of Y adaptors initially and at the same time without inhibiting amplification. The 10 bp actually serve as MID sequences. It truned out good (700M bp in total in one Titanium run, evenly [+/- 5%] distributed for 8 MIDs).
      Last edited by zhengz; 10-19-2010, 10:48 AM.

      Comment


      • #4
        Originally posted by zhengz View Post
        My guess is that using inosines to prevent supressive PCR.

        Inosines allow forming of Y adaptors initially, but after the sencond cycle of amplification, it's sequence on the newly formed strand would be changed, such that it prevents formation of a haipin struction.

        Incidently, I once designed an Y adaptor with a loop of lenght 17 bp, which completely inhibit PCR amplification. From the sequence you provided above, I see that there is an 18bp loop. If inosines were not used, amplification would not work.

        Actually, later I designed a Y adaptor with a loop of only 10 bp, which allows formation of Y adaptor initially and at the same time without inhibiting amplification. It truned out good (700M bp in total in one Titanium run).
        I think you mean "stem", not loop. The stem is where the bases of a single strand of DNA or RNA anneal. The loop is the non-base pairing internal part of the strand.

        Seems like as long as you can crank your concentration of PCR primers high enough, you can overcome the unimolecular kinetics of stem formation. Especially since the loops on these will be >400 bases most of the time. Large loops will destabilize the stems.

        --
        Phillip

        Comment


        • #5
          Sorry for confusing...I use the two words quite often recently and mixed them from time to time.

          Thanks Philip. I did not know that before.

          Comment


          • #6
            That sounds very plausible, thanks for your input!

            Comment


            • #7
              Originally posted by zhengz View Post
              Sorry for confusing...I use the two words quite often recently and mixed them from time to time.

              Thanks Philip. I did not know that before.
              Sure.

              By the way, your Y-primer design was exactly how I presumed Roche would implement Y-primers. It makes perfect sense.

              The deranged, non-Euclidian method they did use nearly gives me a stroke every time I try to grasp it.

              Were you going to tell us more about this 700 MB run? I've heard of people breaking 600 MB on a Titanium run, but never 700 MB.

              --
              Phillip

              Comment


              • #8
                At the first look at the result that gave 711 million bases (1.7 M passFilter reads, median read length ~430 bases, mode read length ~500 bases), I doubted I had made something seriously wrong and the results were not trustable.

                After trimming away the homemade adaptor sequence (I had a Taqman-MGB probe binding site on the B branch), 699 million bases left.

                Results of mapping and De novo assembly looked good - >99.5% of the read mapped to the right bacterial genome, >99.5% of bases were assembled. Then I was not so worried as in the beginning.

                Still, I have no idea why Roche uses several inosies instead of simply shorten the stem, which, like you said, makes perfect sense. Maybe there are other reseasons to use inosies than the issue of suppresive PCR . But, at lease it works for me without using inosies adaptors.

                Comment

                Latest Articles

                Collapse

                • seqadmin
                  Exploring the Dynamics of the Tumor Microenvironment
                  by seqadmin




                  The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
                  07-08-2024, 03:19 PM
                • seqadmin
                  Exploring Human Diversity Through Large-Scale Omics
                  by seqadmin


                  In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
                  06-25-2024, 06:43 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by seqadmin, 07-10-2024, 07:30 AM
                0 responses
                30 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 07-03-2024, 09:45 AM
                0 responses
                202 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 07-03-2024, 08:54 AM
                0 responses
                212 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 07-02-2024, 03:00 PM
                0 responses
                194 views
                0 likes
                Last Post seqadmin  
                Working...
                X