"Homemade" Illumina PE primers

[frozenlyse]

Hi,

Our lab has been optimising an Illumina PE protocol on very small amounts of DNA, ordered the PE amplification primers from the sticky on this forum so we had enough to test different PCR conditions etc.. Does anyone know whether libraries generated with these oligos will be sequencable on the GA IIx? Or do the primers in the Illumina library prep kit have modifications added on necessary for the sequencing?

Thanks,
Aaron

[stelin]

We make libraries using a custom protocol and the PE primer sequences. We use unmodified primers, and that works just fine on the GA IIx.

The commercial primers are modified with phosphorothioate bonds between the two last (3') nucleotides to prevent them from being degraded by the proofreading polymerase (this info based on the Illumina Nature paper). We've just ordered the modified primers (from IDT) and will test them shortly.

/Sten

[seqgirl77]

Hi Stelin, just wondering if you've gotten any results on the modified vs. unmodified primers?

[stelin]

Modified primers

No not yet. In general the unmodified oligos work well, but of course it doesn't hurt to put the modifications in there. So if you're ordering new primers anyway I suggest you make them modified.

[Aero]

Hi,

Our lab has similarly made our own adaptors with the phosphorothioate linkage (Sanger Nature Methods paper) and they work fine on the GAIIx.

[der_eiskern]

we've noticed a dramatic improvement of our library generation when using "homemade" phosphorothioate primers (like the Nature paper) compared to unmodified oligos.

[Patxi]

modified oligos -- adapters & PCR primers?

I find the Nature Methods paper unclear on what oligonucleotides they have synthesized with the phosphorothioate between the last 2 nucleotides at the 3' end -- whether it is the 2 adapter oligos plus the 2 PCR primers or if it is ONLY the adapter oligo with 3' T overhang.

Can anyone clear this up or let me know what their experience is and what they do?

[seqquest]

I too do have similar question.

I got PE PCR Primers (sequences obtained from Illumina) synthesized (PAGE Purified from Operon) and got very nice PCR products. But our sequencing center manager told us that it is tricky and sometimes these products don't sequence well. And also that she needs to add up to 1.5x final concentration than the usual 1x into the final sequencing.

I,m still waiting for my results.

The reaction I have done is RNA Seq.
The adapters that I have used are from Illumina (my leftovers from the kit).
I see very nice PCR bands. So, they did amplify.

So, please help me how exactly I should order my PCR primers? What are the modifications called? Which vendor is the best?

thank you very much.

[advanT]

I had a question for those familiar with paired end dna oligo sequencing.

5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATC*T

Are these PE adapters 5' adenylated or are they just 5' phosphorylated ?
And do they have any 3'ddC blocking groups?
I know illumina says that that they may be additionally modified.....any help would be appreciated.
thank you

[der_eiskern]

advantT, greigite posted a great resource on this topic (see the pdf here):

http://seqanswers.com/forums/showpost.php?p=4493&postcount=26

i believe the phosphorothioate linkages and the 3'T overhang to be the most important (see the link and the Sanger Center's paper): http://www.nature.com/nmeth/journal/...meth.1270.html

der.

[rudi283]

oligos

Hi,
Do you know if there will be any difference from which company we order oligos?
Thanks

[advanT]

PE Adapters

I stopped ordering these adapters alone because they were getting expensive and difficult to ensure they are perfect.
I do my PE work with the kit from Bioo Scientific which has all that you'll need for library prep.
At the end of the day this solution is less costly than sourcing the components myself.