Header Leaderboard Ad

Collapse

i5 index read on NovaSeq

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • i5 index read on NovaSeq

    Hi

    I found the new NovaSeq index read a bit confusing. I have some libraries prep using the old TruSeq PCR primer without index. The company said that they were using v1.5 chemistry on NovaSeq, which should be the reverse method. But they read the "index sequence" on the old index-free TruSeq PCR1 primer as TCTTTCCC. I thought it should be AGATCTCG. They read the i5 on my new TruSeq N5xx primer as i predicted. Something is wrong. I put my PCR primers below:


    ​​​​​​>Old TruSeq_PCR1 (58nt)
    AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

    >new TruSeq N5xx with 8nt index
    AATGATACGGCGACCACCGAGATCTACACCGTCTAATACACTCTTTCCCTACACGACGCTCTTCCGATCT

    截屏2022-08-29 下午4.09.23.png
    source: https://jp.illumina.com/content/dam/...5057455-08.pdf

  • #2
    If they are using an indexed version of Phix this might explain a thing or two, have a look at this:
    https://www.seqmatic.com/wp-content/...ol-Library.pdf

    Comment

    Latest Articles

    Collapse

    • seqadmin
      A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
      by seqadmin


      ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

      01-24-2023, 01:19 PM
    • seqadmin
      Introduction to Single-Cell Sequencing
      by seqadmin
      Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

      The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
      ...
      01-09-2023, 03:10 PM

    ad_right_rmr

    Collapse
    Working...
    X