i5 index read on NovaSeq

[silin284]

Hi

I found the new NovaSeq index read a bit confusing. I have some libraries prep using the old TruSeq PCR primer without index. The company said that they were using v1.5 chemistry on NovaSeq, which should be the reverse method. But they read the "index sequence" on the old index-free TruSeq PCR1 primer as TCTTTCCC. I thought it should be AGATCTCG. They read the i5 on my new TruSeq N5xx primer as i predicted. Something is wrong. I put my PCR primers below:


>Old TruSeq_PCR1 (58nt)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

>new TruSeq N5xx with 8nt index
AATGATACGGCGACCACCGAGATCTACACCGTCTAATACACTCTTTCCCTACACGACGCTCTTCCGATCT


source: https://jp.illumina.com/content/dam/...5057455-08.pdf

[ifixthings]

If they are using an indexed version of Phix this might explain a thing or two, have a look at this:

https://www.seqmatic.com/wp-content/uploads/2014/07/TM-501-Indexed-PhiX-Control-Library.pdf