If they are using an indexed version of Phix this might explain a thing or two, have a look at this:
-
i5 index read on NovaSeq
Hi
I found the new NovaSeq index read a bit confusing. I have some libraries prep using the old TruSeq PCR primer without index. The company said that they were using v1.5 chemistry on NovaSeq, which should be the reverse method. But they read the "index sequence" on the old index-free TruSeq PCR1 primer as TCTTTCCC. I thought it should be AGATCTCG. They read the i5 on my new TruSeq N5xx primer as i predicted. Something is wrong. I put my PCR primers below:
>Old TruSeq_PCR1 (58nt)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>new TruSeq N5xx with 8nt index
AATGATACGGCGACCACCGAGATCTACACCGTCTAATACACTCTTTCCCTACACGACGCTCTTCCGATCT
source: https://jp.illumina.com/content/dam/...5057455-08.pdf
-
NGS has revolutionized clinical microbiology by offering new ways to identify and surveil pathogens without prior knowledge of the target. One popular approach is 16S rRNA and ITS amplicon sequencing, which targets specific microbial markers. But studies are increasingly incorporating shotgun metagenomics, a technique that sequences all DNA from a sample without targeting specific microbial markers. This approach allows more detailed taxonomic classification, detection...Today, 06:46 AM -
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM
Leave a comment: