If they are using an indexed version of Phix this might explain a thing or two, have a look at this:
-
i5 index read on NovaSeq
Hi
I found the new NovaSeq index read a bit confusing. I have some libraries prep using the old TruSeq PCR primer without index. The company said that they were using v1.5 chemistry on NovaSeq, which should be the reverse method. But they read the "index sequence" on the old index-free TruSeq PCR1 primer as TCTTTCCC. I thought it should be AGATCTCG. They read the i5 on my new TruSeq N5xx primer as i predicted. Something is wrong. I put my PCR primers below:
>Old TruSeq_PCR1 (58nt)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>new TruSeq N5xx with 8nt index
AATGATACGGCGACCACCGAGATCTACACCGTCTAATACACTCTTTCCCTACACGACGCTCTTCCGATCT
source: https://jp.illumina.com/content/dam/...5057455-08.pdf
-
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...04-04-2024, 04:25 PM -
Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...03-22-2024, 06:39 AM
Leave a comment: