Tweet
Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?
-
-
Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGEN® QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences.
Addendum : Those are just index/barcode sequences.Last edited by GenoMax; 10-23-2019, 04:48 AM. -
Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.Comment
-
The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.Comment
-
Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?
I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).Comment
-
You may not have any adapters present if your inserts were of a good size and there was no read-through.
BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.Comment
-
It should be TruSeq as FastQC would indicate. I am not sure but you can try following:
Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTComment
-
Thanks a lot!
Comment
-
While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...Yesterday, 07:15 AM -
Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.
Somatic Genomics
“We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...05-24-2024, 01:16 PM
Comment