[AlexJuvion]

Good stuff about solexa genomic adapter and pictures. I am searching for such kind of information and found very useful information. Thanks.
Alex,
http://www.qualityassignment.co.uk/

[babyviva]

Nice.......................................

[pmiguel]

Thanks, Phillip,

I wonder, though, if that has changed since the new Y adapters already contain the flowcell-complementary sequence?

Carmen

"new"? This was already the case when we started making Illumina libraries about 2 years ago.

--
Phillip

[carmeyeii]

Also, for anyone looking, the advantages of having Y-shaped adapters are explained here:

http://seqanswers.com/forums/showthread.php?t=8869

[carmeyeii]

But it obscures a host of library issues that otherwise would have to be dealt with directly. Not the least of which is that some characteristic of the TruSeq adapters in TruSeq Prep kits makes them perform extremely poorly for clustering without at least 1 cycle of "enrichment" PCR.

Thanks, Phillip,

I wonder, though, if that has changed since the new Y adapters already contain the flowcell-complementary sequence?

Carmen

[captainentropy]

Does anyone know if there has been any study that has looked at this issue experimentally? I presume it would be straightforward - sequence a library with and without PCR amplification (during the library construction) and count the number of fragments containing identical 5' starting sequence. I know when I do peak-calling with and without the "collapsing" I typically lose very few reads (suggesting not a lot of identical fragments were created). Plus, those that are made could come from either the library PCR or the cluster generation.

This isn't a peer reviewed paper (it's just a white paper) but it was written by Heng Li, the guy who wrote the Maq alignment program http://lh3lh3.users.sourceforge.net/...ad/PCR-dup.pdf

The basic message is that to reduce PCR duplicates, we should either increase the original pool of distinct molecules before amplication or reduce the number of reads sequenced from the library. Reducing PCR cycles, however, plays little role.

...unless I missed the point of this paper.

[pmiguel]

Hi Carmen,
I think enrichment PCR is the "sawdust in the steering column" of next gen library construction protocols. That is, it is a bad idea (for the reasons you describe.) But it obscures a host of library issues that otherwise would have to be dealt with directly. Not the least of which is that some characteristic of the TruSeq adapters in TruSeq Prep kits makes them perform extremely poorly for clustering without at least 1 cycle of "enrichment" PCR.

Oh, let's tack on the low percentage conversion of library molecules to clusters. 12 pM is roughly 7.2 million molecules/ul. 120 ul required per HS cBot lane comes to 864 million amplicons. (Or is it twice that, because they began the day double-stranded?) 12 pM might get you 180 million clusters. But no one is going to bother to optimize on that factor because enrichment PCR gives you more amplicons than you are ever going to use anyway.

To be fair, it also works around the issues of dealing with very low concentration solutions of DNA. But the original protocol, that Illumina blessed with their official adoption of it, was a no-enrichment protocol.

--
Phillip

[captainentropy]

That's a good question Carmen. I think if you have a sufficiently complex library the duplication of specific reads is probably low. But it will happen regardless. Keeping the cycle numbers low will likely help minimize this as well. This is why most (all?) peak calling programs have, either as default or an option, a peak "collapsing" feature that will eliminate reads that have identical 5' starting sequence.

Keep in mind if the chromatin you ChIP from was generated using restriction enzyme digestion you will certainly have many more reads with identical 5' sequence. We do this frequently in my lab and in these cases I disable the peak collapsing.

[carmeyeii]

Hello everybody,

I have a VERY basic question about the PCR step for the library preparation but I just can't seem to find the answer in my head nor in the literature. Any help is greatly appreciated.

I understand that the reason for doing an amplification step after the adapter ligation is to enrich your sample for adapter-ligated fragments which is what will actually bind to the flowcell oligos - however, doesn't this produce multiple exact copies of fragments, causing a significant amount of duplicate reads, i.e., the exact same fragment in multiple clusters on the flowcell? I suspect I may be missing out on something very basic, pergaps it is very unlikely that two or more copies of fragment x will actually make it to the hybridization step with the oligos on the flow-cell? I just don't see how having multiple clusters of a given fragment would not be a complete waste of computing power and money...

Thanks a lot!

Carmen

[captainentropy]

That's great you got that to work, TonyBrooks. We tried that too and it didn't work well for us. How big of a range can you elute?

[TonyBrooks]

We've just started using the eGel system and it's a great piece of kit. Relatively cheap to buy and run, it's clean and quick (takes about 30 minutes from start to finish). Although it doesn't work well on TruSeq libraries which migrate at funny speeds in the gel.

[captainentropy]

Thanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!

I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?

Thanks!

Size selection is your problem step. The adapters will form a product after PCR of ~124bp. If you size-select your library on a gel you are certainly cutting out your block of DNA-embedded agarose too close to where the adapters run. To avoid this run your library on a long gel and at low voltage, in a cold room is even better (according to Illumina). This should give you better separation of your library from the free adapters.

But, if you have access to a Pippin Prep instrument that will be even better. It will electro-elute your desired size range. It's a much cleaner method.

I've actually abandoned the Pippin and size-select after PCR. I do all of my DNA clean up steps with Ampure XP beads and PCR amplify the library first, then size-select. I never get adapter contamination anymore (I didn't with the Pippin either but my new method is way faster, has greater yield, and is cheaper).

Also, you should always run your library on a Bioanalyzer 2100 before you sequence. You can always size-select your library again to remove the problematic adapter concatamer. Otherwise, without this important quality control step you just might be wasting sequencing depth and wasting money.

[lizhen]

40% adaptor sequence

Thanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!

I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?

Thanks!

[seqgirl123]

Does anyone have a schematic illustration (similar to what kmcarr has posted in this thread for SE and PE library construction and sequencing) when using Illumina's multiplex kits for library construction and sequencing. So far, I have seen the single end and paired end library construction and sequencing illustrations and they have been great learning tools for a lot of us here. Can someone post the same schematic for the multiplex library construction and sequencing?

In Illumina's version of multiplexing, they have a multiplex adapter, multiplex PCR primers, and a separate PCR index primer (3 PCR primers in all). The newer TruSeq kits brought this down to only 2 PCR primers in all, so there is only a multiplex adapter and the multiplex PCR primers (the index sequence is contained in the multiplex PCR primer I think is how it works). So I'm really looking for a schematic on Illumina's original multiplex kit and would much appreciate if someone can post their multiplex illustration here.

[SeqTruth]

Ok, so somebody can maybe post those pdfs on a website somewhere, with some obvious search terms associated, and anyone with access to Google can find and download them; a minor inconvenience for now.

For those of us who already have the pdf with all the TruSeq sequences, it would be nice if someone could clarify the question of library amplification PCR primers for the TruSeq DNA and RNA sample prep kits...?