Tweet
Primers for ZCCHC24
Dear Seqanswer members,
I am desperately trying to amplify/sequence the first exon of the ZCCHC24 gene. I tried it with the following primers
Fwd 5' cgaggcagatagcggatcg 3'
Rev 5' cttggcttggcttcgttcaac 3'
with several polymerases (PeqLab Taq-DNA-Polymerase, TaKaRa rTaq, TaqOne GC Kit) at several annealing temperatures (ranging from 50°C to 60°C). I also tried to add 1 µl DMSO. I get either unspecific products (which do not contain a product of desired length) or there is no product at all.
A former employee already have tried the following primers and failed as well:
Fwd 5' aactttcgctgcctccttc 3'
Rev 5' ctgtctgacccgctcttcct 3'
I don't know which polymerases and programms she used though.
Do you have any ideas, how I could amplify/sequence this exon?
Any suggestions, including primer suggestions are appreciated!
Thank you in advance,
Anna.
I am desperately trying to amplify/sequence the first exon of the ZCCHC24 gene. I tried it with the following primers
Fwd 5' cgaggcagatagcggatcg 3'
Rev 5' cttggcttggcttcgttcaac 3'
with several polymerases (PeqLab Taq-DNA-Polymerase, TaKaRa rTaq, TaqOne GC Kit) at several annealing temperatures (ranging from 50°C to 60°C). I also tried to add 1 µl DMSO. I get either unspecific products (which do not contain a product of desired length) or there is no product at all.
A former employee already have tried the following primers and failed as well:
Fwd 5' aactttcgctgcctccttc 3'
Rev 5' ctgtctgacccgctcttcct 3'
I don't know which polymerases and programms she used though.
Do you have any ideas, how I could amplify/sequence this exon?
Any suggestions, including primer suggestions are appreciated!Thank you in advance,
Anna.
Comment