SAM files aligned by Bowtie - Mystified.

[stqa8350]

Hi,

This is one of my first forays in SOLID data so please bear with me if the question is basic;

I had aligned SOLID data individually (forward, reverse) using bowtie color space -
bowtie -t -p 4 -C --sam --chunkmbs 1000 /Bowtie-Reference/Bowtie-C/h_sapiens_37_asm_c -f read1.csfasta -Q read1.QV.qual read1.sam

I ended up getting a sam file with what appears to me a malformed sam files;

1_2_1079_F3 4 * 0 0 * * 0 0 CCGTGATGGCTACCCCTGGGGTTACATATAAATT *?626A@@:@-@@@@2>>@6*5=**.;.--<@=3 XM:i:0

1_3_10_F3 0 gi|224589818|ref|NC_000006.11| 33410152 255 33M * 0 0 ATTCCCGCCTCTCCTTTCATTTGTCCACATCTC \IFIAGPMOYZL>PRAN`a/#S30FHP?J/!!' XA:i:2 MD:Z:33 NM:i:0 CM:i:4

I kind of figured that "*" on 3rd column, "@" and some CIGAR sequence in the next line as mal-formed elements. I would very much appreciate if anyone can shed some light on this and suggest any solution to this problem.

Thanks

Uma

[westerman]

I am not sure I understand your question. It appears to me that your first SAM line (starting with '1_2...') is a valid line where the read does not map while your second SAM lines (starting with '1_3...') is also a valid line that represents a read that does map.

[dpryan]

I am not sure I understand your question. It appears to me that your first SAM line (starting with '1_2...') is a valid line where the read does not map while your second SAM lines (starting with '1_3...') is also a valid line that represents a read that does map.

One thing I noticed is that the phred scores for the second read span too big of a range to be any of the typical formats.

Edit: Although perhaps it's just not one I've ever seen! I had a reply similar to your written yesterday before noticing the Phred issue.