[ringo1230]

Please tell me the sequence of the adapter of MPL and MPR of Mate-Paired.
I would also like to have a biotin position.
I want to ligate another adapter to blunt-end after ligation the MP adapter.
I'm worried biotin will drop from the adapter by blunt-end.

thanks

[dongyongdong]

Dear yksikaksi,
thanks for your quick reply, and I finally make myself clear about this queation, the P1adapter is fixed on the beads, so the sequence of the 5'-end of the P1 was what I want. Thanks again. best regards.

[yksikaksi]

hello yksikaksi, I noticed you knew many about the SOLiD, so I think maybe you can help me out of my problem: do you know the sequence of the sequencing primer complemented with the P1 adapter, I want to know which of the chains in the dsDNA was binded to the beads, if you know this, could you please reply as soon as possible, thank you very much.

Dear dongyongdong,

Perhaps you could have a look on this post of this thread.

[dongyongdong]

hello yksikaksi, I noticed you knew many about the SOLiD, so I think maybe you can help me out of my problem: do you know the sequence of the sequencing primer complemented with the P1 adapter, I want to know which of the chains in the dsDNA was binded to the beads, if you know this, could you please reply as soon as possible, thank you very much.

[peggywangping]

Oo , I am also curious about the MPL and MPR adaptor, esp it contains a "mysterious" blocking oligo during the circulization step according to the protocol, is there anybody can tell me their "tricks"???


thanks a lot!

[pmiguel]

Hi chiara,
I do not think there should be any NNNNN in SOLiD mate pair adapters. But you would need to explain what you mean by:

I've tried to sequence the IA by Sanger technologies

What exactly did you sequence? That is what did you prime your sequencing reaction with and what were your results?

--
Phillip

[koala]

Dear Phillip,
I'm quite conscious on the SOLiD mate pair library, the steps and the structure of the mate (p1-insert-mpl-mpr-insert-p2) .. it's about one year I'm trying to improve the robustness of the method. Belong to my experience the protocol of the mp isn't satisfactory and mainly replicable.

SO, I'm trying to find other way to overcame some steps that in my opinion are limiting. The circularization is one of these points. The problem to circularize DNA is that the IA (in the 5500 xl is formed by mpr and mpl) contains part of the ligation site for the annealing in sequencing. Therefore, the importance of knowing the IA sequence ( and it is irreplaceable).

I was interested in that post, because you (or someone else) wrote the IA sequence with a string of NNNNN. I thought that my sanger sequence on the IA was with a double signal (2 picks) because of the NNNNN string.
I'm not sure if it's more clear my question on the Mpl Mpr sequence!

thanks for your answers

chiara

[pmiguel]

I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

THANKS chiara

The IA (Internal Adapter) is a "center adapter" in SOLiD mate-pair library construction--the one that attaches the two ends of the large DNA fragment into a circle. I don't want to descend into the depths of mate-pair library construction here, but you end up with:

adapter P1-insert1-IA-insert2-adapter P2

, where the inserts are either end of the same long DNA fragment. You prime one read from inside IA, and the other from P1.

For their bar coding strategy for fragment libraries, ABI decided to re-purpose the mate-pair structure:

adapter P1-insert-IA-BC-adapter P2

Then you get your bar code read from the IA-primed read.

I think you are right, in the most recent iteration of ABI's mate pair library construction kit, the IA would be formed by the hybridization of MPL and MPR. They used to just have a double-stranded internal adapter that allowed circularization via a ligation.

--
Phillip

[koala]

I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

THANKS chiara

[pmiguel]

Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.

Ah, I get it now.

Thanks for your post. I got the extensive patent documentation. I have not carefully read it, but it looks very interesting. ECO had mentioned elsewhere how useful these could be, but I'd never checked for myself.

I am not understanding the motivations for companies to be so secretive about information disclosed publicly in their patent applications. What is up with that?

--
Phillip

[aushev]

Where does the 3' terminal "TGGC" come from?
Phillip

Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.

[pmiguel]

[...]



4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC

Where does the 3' terminal "TGGC" come from?

--
Phillip

[aushev]

While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!

thanks for cautioning, I totally agree, that's why I indicated the source of data.

[ECO]

ok, finally I found by myself
according to published patent [snip]

While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!

[aushev]

And this is how they can be aligned to known P1 and internal adapters mentioned in post #2:

P1 Adapter:
1) 5' -------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT
2) 3' -----TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA NNNNNN

Internal Adapter
3) 5' --------CGTACAtCCGCCTTGGCCGTACAGCAG
4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC