Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
This is a sticky topic.
X
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • mulligan
    replied
    Y-Based SOLiD Adaptors

    Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?

    Leave a comment:


  • Chipper
    replied
    Yes, but you should contact ABI since it is not officaly released yet...

    Leave a comment:


  • atp
    replied
    Does anybody know the sequence of the multiplexing adapters (barcoding) for the SOLiD system?

    Leave a comment:


  • snetmcom
    replied
    there are a few service providers out there. Your best bet would be to contact ABI. Seqwright and Agencourt are the two big ones, but I wouldnt send my samples anywhere other than agencourt.

    Leave a comment:


  • exprofiler
    replied
    thank you !!

    Leave a comment:


  • universalprimer
    replied
    Here are the sequences for most of the current solid oligos, I tried to display it like the post in the solexa forum. I don't know the sequences of the P1 primer on the bead, the actual sequencing primers, or all the "block" oligos.

    SOLiD 2.0 Oligos

    P1 Adapter:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (-) -------------------- -------------------- - 3'
    3' ---------------TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (-) -------------------- -------------------- - 5'

    P2 Adapter:
    5' -------------------- -------------------- ------------------ (-) AGAGAATGAGGAACCCGGGG CAGTT--------------- - 3'
    3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

    Library PCR Primer1:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATG------------- (-) -------------------- -------------------- - 3'
    3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 5'

    Library PCR Primer2:
    5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 3'
    3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

    Resulting Frag Library:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (N) AGAGAATGAGGAACCCGGGG CAG----------------- - 3'
    3' -----------------GG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (N) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'


    Mate pair oligos

    EcoP15I Cap Adapter (note AC 3' overhang on one end)
    5' -------pCTGCTGTAC---------- - 3'
    3' --------GACGACAp----------- - 5'

    Internal Adapter (note: lowercase T in top strand has internal biotin, note GT 3' overhangs for sticky end circularization)
    5' --------CGTACAtCCGCCTTGGCCGT----- - 3'
    3' ------TGGCATGTAGGCGGAACCGG------- - 5'
    Last edited by universalprimer; 09-28-2008, 12:29 PM.

    Leave a comment:


  • exprofiler
    started a topic SOLiD Adapters

    SOLiD Adapters

    Hello,
    I would like to sequence gene expression tags with the SOliD machine-does anybody have the adapter-sequences flanking the inserts or do you know where could I get them?
    Also, is there a relaible service provider for the SOliD system out there ?
    Thank you very much in advance!

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
21 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
46 views
0 likes
Last Post seqadmin  
Working...
X