Y-Based SOLiD Adaptors
Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?
-
Yes, but you should contact ABI since it is not officaly released yet...Leave a comment:
-
Does anybody know the sequence of the multiplexing adapters (barcoding) for the SOLiD system?Leave a comment:
-
there are a few service providers out there. Your best bet would be to contact ABI. Seqwright and Agencourt are the two big ones, but I wouldnt send my samples anywhere other than agencourt.Leave a comment:
-
Here are the sequences for most of the current solid oligos, I tried to display it like the post in the solexa forum. I don't know the sequences of the P1 primer on the bead, the actual sequencing primers, or all the "block" oligos.
SOLiD 2.0 Oligos
P1 Adapter:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (-) -------------------- -------------------- - 3'
3' ---------------TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (-) -------------------- -------------------- - 5'
P2 Adapter:
5' -------------------- -------------------- ------------------ (-) AGAGAATGAGGAACCCGGGG CAGTT--------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'
Library PCR Primer1:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATG------------- (-) -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 5'
Library PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'
Resulting Frag Library:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (N) AGAGAATGAGGAACCCGGGG CAG----------------- - 3'
3' -----------------GG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (N) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'
Mate pair oligos
EcoP15I Cap Adapter (note AC 3' overhang on one end)
5' -------pCTGCTGTAC---------- - 3'
3' --------GACGACAp----------- - 5'
Internal Adapter (note: lowercase T in top strand has internal biotin, note GT 3' overhangs for sticky end circularization)
5' --------CGTACAtCCGCCTTGGCCGT----- - 3'
3' ------TGGCATGTAGGCGGAACCGG------- - 5'Last edited by universalprimer; 09-28-2008, 12:29 PM.Leave a comment:
-
SOLiD Adapters
Hello,
I would like to sequence gene expression tags with the SOliD machine-does anybody have the adapter-sequences flanking the inserts or do you know where could I get them?
Also, is there a relaible service provider for the SOliD system out there
?
Thank you very much in advance!
-
Amplicon sequencing is a targeted approach that allows researchers to investigate specific regions of the genome. This technique is routinely used in applications such as variant identification, clinical research, and infectious disease surveillance. The amplicon sequencing process begins by designing primers that flank the regions of interest. The DNA sequences are then amplified through PCR (typically multiplex PCR) to produce amplicons complementary to the targets. RNA targets...03-21-2023, 01:49 PM -
Targeted sequencing is an effective way to sequence and analyze specific genomic regions of interest. This method enables researchers to focus their efforts on their desired targets, as opposed to other methods like whole genome sequencing that involve the sequencing of total DNA. Utilizing targeted sequencing is an attractive option for many researchers because it is often faster, more cost-effective, and only generates applicable data. While there are many approaches...03-10-2023, 05:31 AM
Leave a comment: