SOLiD Adapters

[mulligan]

Y-Based SOLiD Adaptors

Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?

[Chipper]

Yes, but you should contact ABI since it is not officaly released yet...

[atp]

Does anybody know the sequence of the multiplexing adapters (barcoding) for the SOLiD system?

[snetmcom]

there are a few service providers out there. Your best bet would be to contact ABI. Seqwright and Agencourt are the two big ones, but I wouldnt send my samples anywhere other than agencourt.

[exprofiler]

thank you !!

[universalprimer]

Here are the sequences for most of the current solid oligos, I tried to display it like the post in the solexa forum. I don't know the sequences of the P1 primer on the bead, the actual sequencing primers, or all the "block" oligos.

SOLiD 2.0 Oligos

P1 Adapter:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (-) -------------------- -------------------- - 3'
3' ---------------TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (-) -------------------- -------------------- - 5'

P2 Adapter:
5' -------------------- -------------------- ------------------ (-) AGAGAATGAGGAACCCGGGG CAGTT--------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

Library PCR Primer1:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATG------------- (-) -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 5'

Library PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

Resulting Frag Library:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (N) AGAGAATGAGGAACCCGGGG CAG----------------- - 3'
3' -----------------GG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (N) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'


Mate pair oligos

EcoP15I Cap Adapter (note AC 3' overhang on one end)
5' -------pCTGCTGTAC---------- - 3'
3' --------GACGACAp----------- - 5'

Internal Adapter (note: lowercase T in top strand has internal biotin, note GT 3' overhangs for sticky end circularization)
5' --------CGTACAtCCGCCTTGGCCGT----- - 3'
3' ------TGGCATGTAGGCGGAACCGG------- - 5'

[exprofiler]

Hello,
I would like to sequence gene expression tags with the SOliD machine-does anybody have the adapter-sequences flanking the inserts or do you know where could I get them?
Also, is there a relaible service provider for the SOliD system out there ?
Thank you very much in advance!