Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • vini
    Junior Member
    • Mar 2011
    • 2

    Remove adapter sequence

    Hi,

    I am a newbie in the field of RNA-Seq and i apologize if this query seems too trivial. I have Solid data in fasta format and i am supposed to remove the P2 adapter.

    The P2 adapter sequence is:
    5' ------- (-) AGAGAATGAGGAACCCGGGG CAGTT--- - 3'
    3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5'

    Does this mean that the
    5' ------(-) AGAGAATGAGGAACCCGGGG CAGTT--- -3' will be present at the 3'end of the reads while the
    3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5' would be present at the 5'end of the read?

    Thanks,
    vini
  • KevinLam
    Senior Member
    • Nov 2009
    • 204

    #2
    When you say fasta format did you mean you converted the solid raw data from csfasta to fasta?

    That's generally not advised as it may introduce errors into your reads if there's an upstream miscall on the cs base.
    http://kevin-gattaca.blogspot.com/

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    31 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-23-2026, 11:41 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    214 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    79 views
    0 reactions
    Last Post SEQadmin2  
    Working...