troubleshoot with tophat2 or problem with my fastq files

[manvendra7]

Dear Folks,
I am using TopHat2 to map the reads, I guess, I am fulfilling all the requirements, additionally I give
/usr/local/bin/tophat2 -p 8 -G ~/path/to/Homo_sapiens.GRCh37.72.gtf -o
~/path/to/Human_mapping_iPS_s7_rep1
--splice-mismatches 1 --max-multihits 30 --microexon-search --fusion-search
~/path/to/bowtie2_index/hg19
~/path/to/myfile.fastq

I am submitting on grid engine cluster with qsub -l h_vmem=50G [above_script]
this is showing error as:
"""""TopHat requires all reads be either FASTQ or FASTA. Mixing formats is not supported"""

I am bit frustrated because my fastq files look fine to me as shown in code

@SOLEXA-GA05_00009_SRi_AD_MS_BN_VW:7:1:2364:933#ATGAGCA
NGGCCTTCCCACATTCTTTACACTCATAGGTTTTCTCACCAGTGTGAGTTCTCTTGTGCACAATAAGGTAAGAGCC
+SOLEXA-GA05_00009_SRi_AD_MS_BN_VW:7:1:2364:933#ATGAGCA
!454478347;09977778<655476;69;8588380745<75;57495945158::=677976:7674:64763-

Please help???????
manu

[dpryan]

Don't use an asterisk, you need to use the actual file names. Also, I kind of doubt that your annotation file is actually in the root ("/") directory. Finally, why are you giving tophat2 a fasta file as input (the "/path/to/hg19.fa" shouldn't be there)? You need to reread the tophat2 manual.

[manvendra7]

dpryan reply

Dear dpryan,
Please accept my sincere apologies, I am so sorry,
I was little sleepy while submitting this post, actually there is no problem with tophat, the script written in post is just to convey an impression that I had given these options in tophat2 jobscript ( I had never used asterisk, and had just given path to directory, where my bowtie2 index and ref seq files are there. my tophat2 code is:

/usr/local/bin/tophat2 -p 8 -G ~/path/to/Homo_sapiens.GRCh37.72.gtf -o
~/path/to/Human_mapping_iPS_s7_rep1
--splice-mismatches 1 --max-multihits 30 --microexon-search --fusion-search
~/path/to/bowtie2_index/hg19
~/path/to/myfile.fastq

[dpryan]

Hmm, I don't see anything obviously wrong with that. Your best bet is to just make a minimal version of that command:

tophat2 -p 8 ~/path/to/bowtie2_index/hg19 ~/path/to/myfile.fastq

to ensure that that works (once you're certain it's running properly, you can then just cancel the job). Then start building up the command, a parameter at a time, until it either fails (in which case you've found the issue) or you have the whole thing running (in which case, who knows what the problem was, go have a beer!). Once you've found the problem, kindly post that back here. I can pretty much guarantee that someone else will run into the exact same issue.

[manvendra7]

Dear dpryan,
Thanks a lot, You always help.
My problem was my fastq file