Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • zslee
    Member
    • May 2009
    • 29

    Possible picard bug

    Hey, I am running picard to remove pcr-duplicates using MarkDuplicates.jar
    on bam file porduce by tophat(with fusion-serach on), and I encount:
    Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once.

    I extract the problematic alignment from the bam, I get:
    HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 99 chr1 24288534 50 71M chr10 112724798 0 TAATGATTGTACTTGATATTAAGTGTTCTCAACGGAGTAACTTTTAAGTGGAAACCAAGTTTAGATTTGGG *++++++++'+)+++++++++++++)+++))+++)++**()++++++++++++*++++*****(((((&&& AS:i:-3 XM:i:1 XO:i:0 XG:i:0 MD:Z:37A62 NM:i:1 XF:Z:1 chr1-chr1 24288604 71m118320545F29M CCCAAATCTAAACTTGGTTTCCACTTAAAAGTTACTCCGTTGAGAACACTTAATATCAAGTACAATCATTAAAGTTGCACTGATACTACCATTATATCAC &&&(((((*****++++*++++++++++++)(**++)+++))+++)+++++++++++++)+'++++++++*+)))&')**(***(((((('&&'''('&& XP:Z:chr10 112724798 22M35353N78M NH:i:1
    HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 99 chr1 118320545 50 29M chr10 112724798 0 AAGTTGCACTGATACTACCATTATATCAC +)))&')**(***(((((('&&'''('&& AS:i:-3 XM:i:1 XO:i:0 XG:i:0 MD:Z:37A62 NM:i:1 XF:Z:2 chr1-chr1 24288604 71m118320545F29M CCCAAATCTAAACTTGGTTTCCACTTAAAAGTTACTCCGTTGAGAACACTTAATATCAAGTACAATCATTAAAGTTGCACTGATACTACCATTATATCAC &&&(((((*****++++*++++++++++++)(**++)+++))+++)+++++++++++++)+'++++++++*+)))&')**(***(((((('&&'''('&& XP:Z:chr10 112724798 22M35353N78M NH:i:1
    HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 147 chr10 112724798 50 22M35353N78M chr1 24288604 0 TGACAACTACCTGCTGAAATTGGAAACCTGTCCAGTTTAAGTCGTCTTGGTCTGAGATATAACAGACTGTCAGCAATACCCAGATCATTAGCAAAATGCA &&&&"!$#!&'''''''%'('&&****(++*)')++')++(+*'+)++))*'&'+)+++**)*')*+++++*+++)*&++++*++++**))*(((((&&& XA:i:2 MD:Z:0A0A98 NM:i:2 XS:A:+ XP:Z:chr1-chr1 24288604 71m118320544F29M NH:i:1

    yes, one end reported twice because of splited alignment, so, how to deal with this? or it is a bug ?

    thanks for any discussion in advance.
  • TiborNagy
    Senior Member
    • Mar 2010
    • 329

    #2
    Replace the read ids with unique values.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      Yesterday, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 11:10 AM
    0 responses
    9 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    30 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    40 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    25 views
    0 reactions
    Last Post SEQadmin2  
    Working...