Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • zslee
    Member
    • May 2009
    • 29

    #1

    Possible picard bug

    Hey, I am running picard to remove pcr-duplicates using MarkDuplicates.jar
    on bam file porduce by tophat(with fusion-serach on), and I encount:
    Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once.

    I extract the problematic alignment from the bam, I get:
    HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 99 chr1 24288534 50 71M chr10 112724798 0 TAATGATTGTACTTGATATTAAGTGTTCTCAACGGAGTAACTTTTAAGTGGAAACCAAGTTTAGATTTGGG *++++++++'+)+++++++++++++)+++))+++)++**()++++++++++++*++++*****(((((&&& AS:i:-3 XM:i:1 XO:i:0 XG:i:0 MD:Z:37A62 NM:i:1 XF:Z:1 chr1-chr1 24288604 71m118320545F29M CCCAAATCTAAACTTGGTTTCCACTTAAAAGTTACTCCGTTGAGAACACTTAATATCAAGTACAATCATTAAAGTTGCACTGATACTACCATTATATCAC &&&(((((*****++++*++++++++++++)(**++)+++))+++)+++++++++++++)+'++++++++*+)))&')**(***(((((('&&'''('&& XP:Z:chr10 112724798 22M35353N78M NH:i:1
    HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 99 chr1 118320545 50 29M chr10 112724798 0 AAGTTGCACTGATACTACCATTATATCAC +)))&')**(***(((((('&&'''('&& AS:i:-3 XM:i:1 XO:i:0 XG:i:0 MD:Z:37A62 NM:i:1 XF:Z:2 chr1-chr1 24288604 71m118320545F29M CCCAAATCTAAACTTGGTTTCCACTTAAAAGTTACTCCGTTGAGAACACTTAATATCAAGTACAATCATTAAAGTTGCACTGATACTACCATTATATCAC &&&(((((*****++++*++++++++++++)(**++)+++))+++)+++++++++++++)+'++++++++*+)))&')**(***(((((('&&'''('&& XP:Z:chr10 112724798 22M35353N78M NH:i:1
    HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 147 chr10 112724798 50 22M35353N78M chr1 24288604 0 TGACAACTACCTGCTGAAATTGGAAACCTGTCCAGTTTAAGTCGTCTTGGTCTGAGATATAACAGACTGTCAGCAATACCCAGATCATTAGCAAAATGCA &&&&"!$#!&'''''''%'('&&****(++*)')++')++(+*'+)++))*'&'+)+++**)*')*+++++*+++)*&++++*++++**))*(((((&&& XA:i:2 MD:Z:0A0A98 NM:i:2 XS:A:+ XP:Z:chr1-chr1 24288604 71m118320544F29M NH:i:1

    yes, one end reported twice because of splited alignment, so, how to deal with this? or it is a bug ?

    thanks for any discussion in advance.
  • TiborNagy
    Senior Member
    • Mar 2010
    • 329

    #2
    Replace the read ids with unique values.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    17 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    15 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-23-2026, 11:41 AM
    0 responses
    13 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    24 views
    0 reactions
    Last Post SEQadmin2  
    Working...