Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • wlnjseu
    Junior Member
    • Aug 2010
    • 8

    #1

    Single-end SOLiD data for TopHat

    Hi

    I have some single-end SOLiD data about 35bp. run TopHat.
    There are some questions about TopHat. I use TopHat to produce accepted_hits.bam, but "Error Can't read file: accepted_hits.bam" in UCSC.
    Cufflinks use SAM, however, TopHat produce BAM and not SAM.
    How the maximal reads data is?
    There is a question "Error: segment-based junction search failed with err = -11"

    I look forward to everyone letter.

    Thank you
  • krobison
    Senior Member
    • Nov 2007
    • 734

    #2
    BAM to SAM is an easy one

    Code:
    samtools view accepted_hits.bam > accepted_hits.sam
    I haven't seen that error message, but plenty of others! You might check through this recent thread (definitely make sure you have 1.1.1 -- which I need to go install)

    Comment

    • Pejman
      Member
      • Jul 2010
      • 23

      #3
      Originally posted by wlnjseu View Post
      Hi
      Cufflinks use SAM, however, TopHat produce BAM and not SAM.
      Cufflinks accepts BAM, there should be some other problem, Do make sure that you're using the very last version though!

      Comment

      • wlnjseu
        Junior Member
        • Aug 2010
        • 8

        #4
        Single-end SOLiD data for TopHat

        I am a new hand on RNA-Seq. I used TopHat1.1.1 to produce Bam, but it didn't support in UCSC.
        I convert Bam to SAM.
        SAM:979_695_572_F3 0 chr1 564895 1 35M * 0 0 AGAACCCATCCCTGAGAATCCAAAATTCTCCGTGC qqq!!qqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:1 NH:i:3 CC:Z:chr2 CP:i:132143154
        986_1661_1934_F3 0 chr1 564911 3 35M * 0 0 AACTCAAAATTCTCCGTGCCACCTATCACACCCCA qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:2 NH:i:2 CC:Z:chrM CP:i:4362
        977_724_1577_F3 0 chr1 564914 3 35M * 0 0 CCAAAATTCTCCGTGCCACCTATCACACCCCATCC qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:0 NH:i:2 CC:Z:chrM CP:i:4365
        966_1378_922_F3 0 chr1 564915 3 35M * 0 0 CAACATTCTCCGTGCCACCTATCACACCCCATCCT qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:1 NH:i:2 CC:Z:chrM CP:i:4366

        If the mapping position of the query is not available, RNAME and CIGAR are set as “*”, and POS and MAPQ as 0.
        I think the question maybe lead to error in UCSC, some suggestions?
        I look forward to everyone letter
        thank you
        Last edited by wlnjseu; 10-14-2010, 07:49 PM. Reason: add content

        Comment

        • wlnjseu
          Junior Member
          • Aug 2010
          • 8

          #5
          Single-end SOLiD data for TopHat

          Last edited by wlnjseu; 10-14-2010, 08:12 PM. Reason: repeat

          Comment

          • krobison
            Senior Member
            • Nov 2007
            • 734

            #6
            This isn't a paid helpline; you really should be patient.

            Try using "head" to take slices of your SAM file & see if they upload; alternatively use your favorite language to split the SAM file into N equal chunks (you might use samtools to filter out the unmapped reads first). That will help you figure out where an example of actually troublesome data is (unless it really is just the size of your file) & really get to the bottom of it.

            Comment

            • Pejman
              Member
              • Jul 2010
              • 23

              #7
              I havn't used UCSD genome browser myself, but as far as I heard it's more desirable to upload wiggle files there, since SAM is huge.
              and about yor problem with the "*" ones, those are the reads that are not aligned to anywhere, you may check if UCSD browser needs only the aligned ones. In that case you can simply remove all of the non-aligned sequences from your SAM file using sth like this in bash:
              Code:
              gawk '$3!="*"' File_with_non-aligneds.sam  >File_with_only_aligned.sam
              hope this helps

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 08-06-2026, 07:41 AM
              0 responses
              14 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-03-2026, 10:13 AM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-31-2026, 02:55 AM
              0 responses
              40 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              26 views
              0 reactions
              Last Post SEQadmin2  
              Working...