Single-end SOLiD data for TopHat

[wlnjseu]

Hi

I have some single-end SOLiD data about 35bp. run TopHat.
There are some questions about TopHat. I use TopHat to produce accepted_hits.bam, but "Error Can't read file: accepted_hits.bam" in UCSC.
Cufflinks use SAM, however, TopHat produce BAM and not SAM.
How the maximal reads data is?
There is a question "Error: segment-based junction search failed with err = -11"

I look forward to everyone letter.

Thank you

[krobison]

BAM to SAM is an easy one

samtools view accepted_hits.bam > accepted_hits.sam

I haven't seen that error message, but plenty of others! You might check through this recent thread (definitely make sure you have 1.1.1 -- which I need to go install)

[Pejman]

Hi
Cufflinks use SAM, however, TopHat produce BAM and not SAM.

Cufflinks accepts BAM, there should be some other problem, Do make sure that you're using the very last version though!

[wlnjseu]

Single-end SOLiD data for TopHat

I am a new hand on RNA-Seq. I used TopHat1.1.1 to produce Bam, but it didn't support in UCSC.
I convert Bam to SAM.
SAM:979_695_572_F3 0 chr1 564895 1 35M * 0 0 AGAACCCATCCCTGAGAATCCAAAATTCTCCGTGC qqq!!qqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:1 NH:i:3 CC:Z:chr2 CP:i:132143154
986_1661_1934_F3 0 chr1 564911 3 35M * 0 0 AACTCAAAATTCTCCGTGCCACCTATCACACCCCA qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:2 NH:i:2 CC:Z:chrM CP:i:4362
977_724_1577_F3 0 chr1 564914 3 35M * 0 0 CCAAAATTCTCCGTGCCACCTATCACACCCCATCC qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:0 NH:i:2 CC:Z:chrM CP:i:4365
966_1378_922_F3 0 chr1 564915 3 35M * 0 0 CAACATTCTCCGTGCCACCTATCACACCCCATCCT qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq NM:i:1 NH:i:2 CC:Z:chrM CP:i:4366

If the mapping position of the query is not available, RNAME and CIGAR are set as “*”, and POS and MAPQ as 0.
I think the question maybe lead to error in UCSC, some suggestions?
I look forward to everyone letter
thank you

[wlnjseu]

Single-end SOLiD data for TopHat

[krobison]

This isn't a paid helpline; you really should be patient.

Try using "head" to take slices of your SAM file & see if they upload; alternatively use your favorite language to split the SAM file into N equal chunks (you might use samtools to filter out the unmapped reads first). That will help you figure out where an example of actually troublesome data is (unless it really is just the size of your file) & really get to the bottom of it.

[Pejman]

I havn't used UCSD genome browser myself, but as far as I heard it's more desirable to upload wiggle files there, since SAM is huge.
and about yor problem with the "*" ones, those are the reads that are not aligned to anywhere, you may check if UCSD browser needs only the aligned ones. In that case you can simply remove all of the non-aligned sequences from your SAM file using sth like this in bash:

gawk '$3!="*"' File_with_non-aligneds.sam  >File_with_only_aligned.sam

hope this helps