TruSeq PCR enrichment primers

[seangallaher]

Does anyone know the sequences of the PCR enrichment primers from the Illumina TruSeq kit (the PPC primers)? I have the adaptor sequences, so I know what the 5' end of each sequence should be, but I don't know how long they are.

Additional info:
I tried the sequences from the OpenWetWare protocol in this thread:

http://seqanswers.com/forums/showthread.php?t=12342

They are as follows:
P5_PCR: AATGATACGGCGACCACCGAG
P7_PCR: CAAGCAGAAGACGGCATACGAG
These do amplify the library, but they are very inefficient compared to the PPC primers in the kit.

I have seen other examples of primers in the literature that are longer. However, the longer ones that I have seen include the region of P7 where the index is. I hope I do not need to make a separate P7 primer for each index in order to preserve my ability to multiplex. I'm sure that is not how the PPC primers work.

Thanks!

Sean

[ageneheo]

Re:

Hi seangallaher,

I need to order Truseq PCR primers soon.

Could you provide a gel picture of PCR amplified P5 & P7 PCR primers and PPC primers?

Thanks,

[kwaraska]

From a paper

We use the sequences we got from a paper by Geller from April 2011. I was only given the appendix so I am not sure but I assume the paper is called "High Throughput Indexed Library Preparation and Pooled Agilent Exome Enrichment" It has the sequences of the PCR primers as well as the adapter sequences. We use them here and they work very well.

That being said-can I say that they re exactly what is in the Illumina primer cocktail-no, but they work for us and we are a core facility so we make many libraries.

[ageneheo]

Hi Kwaraska,

Do you use PCR primers with phosphorothilated modification?

[kwaraska]

PCR primers

No the PCR primers we just use HPLC purified, but we do add the phosphothioate to the adapters.

[seangallaher]

Hi seangallaher,

I need to order Truseq PCR primers soon.

Could you provide a gel picture of PCR amplified P5 & P7 PCR primers and PPC primers?

Thanks,

Here is a PCR reaction I did on a qPCR thermocycler with added SYBR green. I used Phusion polymerase with the P5/P7 primers vs. the Illumina reagents and the same template. The Phusion reaction is retarded by over 11 cycles!

[seangallaher]

We use the sequences we got from a paper by Geller from April 2011. I was only given the appendix so I am not sure but I assume the paper is called "High Throughput Indexed Library Preparation and Pooled Agilent Exome Enrichment" It has the sequences of the PCR primers as well as the adapter sequences. We use them here and they work very well.

That being said-can I say that they re exactly what is in the Illumina primer cocktail-no, but they work for us and we are a core facility so we make many libraries.

Those are the same primers (P5 and P7) that I tried (albeit with Phusion polymerase). Do you use the same reagents (Herculase II polymerase) and thermocycler protocol as they indicate in the Geller protocol?

[kwaraska]

No-we use the Kapa Master Mix. We found it better for GC rich templates so it became our standard.

[luc]

We also use the Kapa-Hifi mastermix, an annealing temperature of 62 degrees, and PCR primers as detailed in:

http://genomics.med.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf

Actually, our PCR-Primer1 is two bases shorter and ends with "...TACAC".

For phusion, the recomended annealing temperature is 65 degrees, but this enzyme introduces strong GC biases.

http://www.biotechniques.com/BiotechniquesJournal/2012/February/Length-and-GC-biases-during-sequencing-library-amplification-A-comparison-of----various-polymerase-buffer-systems-with-ancient-and-modern-DNA-sequencing----libraries/biotechniques-326018.html

No-we use the Kapa Master Mix. We found it better for GC rich templates so it became our standard.

[seangallaher]

We also use the Kapa-Hifi mastermix, an annealing temperature of 62 degrees, and PCR primers as detailed in:

http://genomics.med.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf

Actually, our PCR-Primer1 is two bases shorter and ends with "...TACAC".

For phusion, the recomended annealing temperature is 65 degrees, but this enzyme introduces strong GC biases.

http://www.biotechniques.com/Biotech...es-326018.html

Thanks for the info, but I'm confused. If I am not mistaken, the last 3 nt of PCR primer 2.0 in the Tufts protocol overlap with the index. Have you used that primer with indexed libraries? If I'm right, those primers would change the index so that 1/2 of it is the same in every library?

[luc]

Hi Sean,
PCR primer 1 is homologous to the 5'end of the universal adapter in the Tufts protocol.
PCR primer 2 is homologous to the inverse complement of the barcoded adapter - to the 3'end as it is displayed in the protocol on page 3. It does not overlap with the barcode.

Thanks for the info, but I'm confused. If I am not mistaken, the last 3 nt of PCR primer 2.0 in the Tufts protocol overlap with the index. Have you used that primer with indexed libraries? If I'm right, those primers would change the index so that 1/2 of it is the same in every library?

[seangallaher]

Hi Sean,
PCR primer 1 is homologous to the 5'end of the universal adapter in the Tufts protocol.
PCR primer 2 is homologous to the inverse complement of the barcoded adapter - to the 3'end as it is displayed in the protocol on page 3. It does not overlap with the barcode.

I mapped it out again, and you are absolutely correct.

One more question: Why did you shorten PCR-primer1? To favorably alter the melting temperature? Did you try it both with and without the extra two nucleotides?

Thanks so much for your help!

[luc]

Hi Sean,

there was no specific reason for the shorter primer. We got the sequences like this from another lab.

[JamieHeather]

I've not compared the sequences, but I use a 3' shortened version of P5 when I'm amplifying my libraries, just to bring the Tm in line with P7.