Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • seangallaher
    Junior Member
    • Sep 2011
    • 5

    #1

    TruSeq PCR enrichment primers

    Does anyone know the sequences of the PCR enrichment primers from the Illumina TruSeq kit (the PPC primers)? I have the adaptor sequences, so I know what the 5' end of each sequence should be, but I don't know how long they are.

    Additional info:
    I tried the sequences from the OpenWetWare protocol in this thread:
    Bridged amplification & clustering followed by sequencing by synthesis. (Genome Analyzer / HiSeq / MiSeq)

    They are as follows:
    P5_PCR: AATGATACGGCGACCACCGAG
    P7_PCR: CAAGCAGAAGACGGCATACGAG
    These do amplify the library, but they are very inefficient compared to the PPC primers in the kit.

    I have seen other examples of primers in the literature that are longer. However, the longer ones that I have seen include the region of P7 where the index is. I hope I do not need to make a separate P7 primer for each index in order to preserve my ability to multiplex. I'm sure that is not how the PPC primers work.

    Thanks!

    Sean
  • ageneheo
    Junior Member
    • Sep 2012
    • 4

    #2
    Re:

    Hi seangallaher,

    I need to order Truseq PCR primers soon.

    Could you provide a gel picture of PCR amplified P5 & P7 PCR primers and PPC primers?

    Thanks,

    Comment

    • kwaraska
      Senior Member
      • Nov 2008
      • 131

      #3
      From a paper

      We use the sequences we got from a paper by Geller from April 2011. I was only given the appendix so I am not sure but I assume the paper is called "High Throughput Indexed Library Preparation and Pooled Agilent Exome Enrichment" It has the sequences of the PCR primers as well as the adapter sequences. We use them here and they work very well.

      That being said-can I say that they re exactly what is in the Illumina primer cocktail-no, but they work for us and we are a core facility so we make many libraries.

      Comment

      • ageneheo
        Junior Member
        • Sep 2012
        • 4

        #4
        Hi Kwaraska,

        Do you use PCR primers with phosphorothilated modification?

        Comment

        • kwaraska
          Senior Member
          • Nov 2008
          • 131

          #5
          PCR primers

          No the PCR primers we just use HPLC purified, but we do add the phosphothioate to the adapters.

          Comment

          • seangallaher
            Junior Member
            • Sep 2011
            • 5

            #6
            Originally posted by ageneheo View Post
            Hi seangallaher,

            I need to order Truseq PCR primers soon.

            Could you provide a gel picture of PCR amplified P5 & P7 PCR primers and PPC primers?

            Thanks,
            Here is a PCR reaction I did on a qPCR thermocycler with added SYBR green. I used Phusion polymerase with the P5/P7 primers vs. the Illumina reagents and the same template. The Phusion reaction is retarded by over 11 cycles!
            Attached Files

            Comment

            • seangallaher
              Junior Member
              • Sep 2011
              • 5

              #7
              Originally posted by kwaraska View Post
              We use the sequences we got from a paper by Geller from April 2011. I was only given the appendix so I am not sure but I assume the paper is called "High Throughput Indexed Library Preparation and Pooled Agilent Exome Enrichment" It has the sequences of the PCR primers as well as the adapter sequences. We use them here and they work very well.

              That being said-can I say that they re exactly what is in the Illumina primer cocktail-no, but they work for us and we are a core facility so we make many libraries.
              Those are the same primers (P5 and P7) that I tried (albeit with Phusion polymerase). Do you use the same reagents (Herculase II polymerase) and thermocycler protocol as they indicate in the Geller protocol?

              Comment

              • kwaraska
                Senior Member
                • Nov 2008
                • 131

                #8
                No-we use the Kapa Master Mix. We found it better for GC rich templates so it became our standard.

                Comment

                • luc
                  Senior Member
                  • Dec 2010
                  • 469

                  #9
                  We also use the Kapa-Hifi mastermix, an annealing temperature of 62 degrees, and PCR primers as detailed in:


                  Actually, our PCR-Primer1 is two bases shorter and ends with "...TACAC".

                  For phusion, the recomended annealing temperature is 65 degrees, but this enzyme introduces strong GC biases.







                  Originally posted by kwaraska View Post
                  No-we use the Kapa Master Mix. We found it better for GC rich templates so it became our standard.

                  Comment

                  • seangallaher
                    Junior Member
                    • Sep 2011
                    • 5

                    #10
                    Originally posted by luc View Post
                    We also use the Kapa-Hifi mastermix, an annealing temperature of 62 degrees, and PCR primers as detailed in:


                    Actually, our PCR-Primer1 is two bases shorter and ends with "...TACAC".

                    For phusion, the recomended annealing temperature is 65 degrees, but this enzyme introduces strong GC biases.

                    http://www.biotechniques.com/Biotech...es-326018.html
                    Thanks for the info, but I'm confused. If I am not mistaken, the last 3 nt of PCR primer 2.0 in the Tufts protocol overlap with the index. Have you used that primer with indexed libraries? If I'm right, those primers would change the index so that 1/2 of it is the same in every library?

                    Comment

                    • luc
                      Senior Member
                      • Dec 2010
                      • 469

                      #11
                      Hi Sean,
                      PCR primer 1 is homologous to the 5'end of the universal adapter in the Tufts protocol.
                      PCR primer 2 is homologous to the inverse complement of the barcoded adapter - to the 3'end as it is displayed in the protocol on page 3. It does not overlap with the barcode.

                      Originally posted by seangallaher View Post
                      Thanks for the info, but I'm confused. If I am not mistaken, the last 3 nt of PCR primer 2.0 in the Tufts protocol overlap with the index. Have you used that primer with indexed libraries? If I'm right, those primers would change the index so that 1/2 of it is the same in every library?

                      Comment

                      • seangallaher
                        Junior Member
                        • Sep 2011
                        • 5

                        #12
                        Originally posted by luc View Post
                        Hi Sean,
                        PCR primer 1 is homologous to the 5'end of the universal adapter in the Tufts protocol.
                        PCR primer 2 is homologous to the inverse complement of the barcoded adapter - to the 3'end as it is displayed in the protocol on page 3. It does not overlap with the barcode.
                        I mapped it out again, and you are absolutely correct.

                        One more question: Why did you shorten PCR-primer1? To favorably alter the melting temperature? Did you try it both with and without the extra two nucleotides?

                        Thanks so much for your help!

                        Comment

                        • luc
                          Senior Member
                          • Dec 2010
                          • 469

                          #13
                          Hi Sean,

                          there was no specific reason for the shorter primer. We got the sequences like this from another lab.

                          Comment

                          • JamieHeather
                            @jamimmunology
                            • Nov 2012
                            • 96

                            #14
                            I've not compared the sequences, but I use a 3' shortened version of P5 when I'm amplifying my libraries, just to bring the Tm in line with P7.

                            Comment

                            Latest Articles

                            Collapse

                            • SEQadmin2
                              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                              by SEQadmin2



                              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                              Despite this, “CRISPR helped turn genome editing from a specialized technique into
                              ...
                              07-31-2026, 11:01 AM
                            • SEQadmin2
                              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                              by SEQadmin2


                              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                              The systematic characterization of the human proteome has
                              ...
                              07-20-2026, 11:48 AM
                            • SEQadmin2
                              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                              by SEQadmin2



                              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                              ...
                              07-09-2026, 11:10 AM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by SEQadmin2, Yesterday, 10:13 AM
                            0 responses
                            14 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-31-2026, 02:55 AM
                            0 responses
                            29 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-24-2026, 12:17 PM
                            0 responses
                            23 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-23-2026, 11:41 AM
                            0 responses
                            21 views
                            0 reactions
                            Last Post SEQadmin2  
                            Working...