Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • letusgo
    Member
    • Aug 2011
    • 17

    #1

    fastx_toolkit can't work

    when i use fastx_toolkits ,just like fastq_quality_filter:

    $ fastq_quality_filter -q 5 -p 50 -i ./SampleS_1.fq -o ./SampleSfilter_1.fq

    unfortunately,it returns as:

    fastq_quality_filter: Invalid quality score value (char '#' ord 35 quality value -29) on line 4

    how can I solve it ?
  • Alex Renwick
    Member
    • Jul 2011
    • 44

    #2
    The program is using solexa quality scores (starting at 64) instead of sanger (starting at 33). According to the fastx website, support for sanger quality scores was added in version 0.0.13. Which version are you running?

    Comment

    • dfjenkins3
      Junior Member
      • Aug 2011
      • 1

      #3
      Try the command line option -Q 33 to indicate Sanger phred scores. That option has worked for me in the past

      Comment

      • letusgo
        Member
        • Aug 2011
        • 17

        #4
        Originally posted by Alex Renwick View Post
        The program is using solexa quality scores (starting at 64) instead of sanger (starting at 33). According to the fastx website, support for sanger quality scores was added in version 0.0.13. Which version are you running?
        i use the version 0.0.13,but it doesn't work too,how can i convert sanger fastq to illumina fastq format?

        Comment

        • letusgo
          Member
          • Aug 2011
          • 17

          #5
          Originally posted by dfjenkins3 View Post
          Try the command line option -Q 33 to indicate Sanger phred scores. That option has worked for me in the past
          i add this option ,but another error is happened like:

          fastq_quality_filter: Invalid quality score value (char 'J' ord 74 quality value 41) on line 4

          Comment

          • sisch
            Member
            • Jun 2011
            • 29

            #6
            Can you post a few (12) lines of your FastQ file?

            Comment

            • mgogol
              Senior Member
              • Mar 2008
              • 197

              #7
              I always thought it was -Q33... Does -Q 33 work?

              [edit] Oh, yes, it does.

              Comment

              • letusgo
                Member
                • Aug 2011
                • 17

                #8
                Originally posted by sisch View Post
                can you post a few (12) lines of your fastq file?
                @hwi-st298:170:81mg3abxx:1:1101:1349:2455 1:n:0:ttaggc
                ctggttcagccttcttaggctcttcttctgtttccttacctcagatcggaagagcacacgtctgaactccagtcacttaggcatttcgtatgacgtatgt
                +
                cccfffffghghfhgiijjfhegi?fhiihfchggggcegggicgebchfhgdhgiiibaf@fh7@@e;7=a;aadd>ccbcca################
                @hwi-st298:170:81mg3abxx:1:1101:1372:2461 1:n:0:ttaggc
                agacggtgttgcataagctgttgtatctgttgctgttgaaactgaaactgctgctgttgctgcttttgttttttagatcggcagggcacacgtgtgcgac
                +
                @@@fff@dfhgff<gaeehggg@@ehafhiiibgg<?ff<?<bf<fg@gg?be<<3?88bf#######################################
                @hwi-st298:170:81mg3abxx:1:1101:1866:2486 1:n:0:ttaggc
                gtcactttgtacctcttctcaaattaggaaaatacgaagttcgaggaacgcctttcgttctctttttttcttggtcggcagggtcagggcctttcttgct
                +
                @@cdffffdddhhegeggeegeh>hhhiigiij>ffcgggeghid0?dfdfggiig1=;;ceggcac<<ce@a@>>>;??>95(9<(38<?<a#######

                Comment

                • kmcarr
                  Senior Member
                  • May 2008
                  • 1181

                  #9
                  Originally posted by letusgo View Post
                  i add this option ,but another error is happened like:

                  fastq_quality_filter: Invalid quality score value (char 'J' ord 74 quality value 41) on line 4
                  letusgo,

                  Are you sure that you are using v. 0.0.13? See this response to a thread about this issue from last year. (Hint, try searching the forum first, your question may already have been answered.) Using v. 0.0.13 and the '-Q 33' option together should work. If it doesn't then your FASTQ file may be malformed.

                  Comment

                  • letusgo
                    Member
                    • Aug 2011
                    • 17

                    #10
                    Originally posted by mgogol View Post
                    I always thought it was -Q33... Does -Q 33 work?

                    [edit] Oh, yes, it does.
                    unfortunately,it doesn't work for my fastq files,then i convert the sanger fastq to illumina fastq.when i run fastq_quality_filter,another error :

                    fastq_quality_filter: Invalid quality score value (char 'i' ord 105 quality value 41) on line 4

                    Comment

                    • kmcarr
                      Senior Member
                      • May 2008
                      • 1181

                      #11
                      Originally posted by letusgo View Post
                      @hwi-st298:170:81mg3abxx:1:1101:1349:2455 1:n:0:ttaggc
                      ctggttcagccttcttaggctcttcttctgtttccttacctcagatcggaagagcacacgtctgaactccagtcacttaggcatttcgtatgacgtatgt
                      +
                      cccfffffghghfhgiijjfhegi?fhiihfchggggcegggicgebchfhgdhgiiibaf@fh7@@e;7=a;aadd>ccbcca################
                      @hwi-st298:170:81mg3abxx:1:1101:1372:2461 1:n:0:ttaggc
                      agacggtgttgcataagctgttgtatctgttgctgttgaaactgaaactgctgctgttgctgcttttgttttttagatcggcagggcacacgtgtgcgac
                      +
                      @@@fff@dfhgff<gaeehggg@@ehafhiiibgg<?ff<?<bf<fg@gg?be<<3?88bf#######################################
                      @hwi-st298:170:81mg3abxx:1:1101:1866:2486 1:n:0:ttaggc
                      gtcactttgtacctcttctcaaattaggaaaatacgaagttcgaggaacgcctttcgttctctttttttcttggtcggcagggtcagggcctttcttgct
                      +
                      @@cdffffdddhhegeggeegeh>hhhiigiij>ffcgggeghid0?dfdfggiig1=;;ceggcac<<ce@a@>>>;??>95(9<(38<?<a#######
                      O.K. I missed this before. Clearly your quality lines are malformed; are these after you converted them? You have ASCII values ranging from 35 (#) to 105 (i). No valid FASTQ files for Illumina reads uses a range this wide.

                      Comment

                      • letusgo
                        Member
                        • Aug 2011
                        • 17

                        #12
                        Originally posted by kmcarr View Post
                        O.K. I missed this before. Clearly your quality lines are malformed; are these after you converted them? You have ASCII values ranging from 35 (#) to 105 (i). No valid FASTQ files for Illumina reads uses a range this wide.
                        they come from a seqencing company,i didn't convert them.but when i convert them to Illumina fastq,their ASCII values is also malformed,what can i do?

                        Comment

                        • arvid
                          Senior Member
                          • Jul 2011
                          • 156

                          #13
                          Originally posted by letusgo View Post
                          they come from a seqencing company,i didn't convert them.but when i convert them to Illumina fastq,their ASCII values is also malformed,what can i do?
                          Ask the company what they did to create such data..?

                          Comment

                          • ishmael
                            Member
                            • Jul 2008
                            • 17

                            #14
                            Just curious, I googled the unique machine id: hwi-st298.
                            And I found this:
                            http://seqanswers.com/forums/showthread.php?t=15928
                            It looks that the company triggered the malformation not the first time.
                            Which company it is? BGI?

                            Comment

                            Latest Articles

                            Collapse

                            • SEQadmin2
                              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                              by SEQadmin2


                              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                              The systematic characterization of the human proteome has
                              ...
                              07-20-2026, 11:48 AM
                            • SEQadmin2
                              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                              by SEQadmin2



                              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                              ...
                              07-09-2026, 11:10 AM
                            • SEQadmin2
                              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                              by SEQadmin2



                              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                              07-08-2026, 05:17 AM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by SEQadmin2, Today, 02:55 AM
                            0 responses
                            4 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-24-2026, 12:17 PM
                            0 responses
                            10 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-23-2026, 11:41 AM
                            0 responses
                            11 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-20-2026, 11:10 AM
                            0 responses
                            24 views
                            0 reactions
                            Last Post SEQadmin2  
                            Working...