Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • vishnuamaram
    replied
    Hey persorrels,

    If i was in your place, i proceed this way.

    I suggest you trim the first 4 bases and run FASTQC on the trimmed file and checked the QC chart.

    --> If you see the mean quality- the blue line it falls more or less near 30, above 28.
    --> The median quality- the red line is above 30 for all bases.

    That means, only certain reads bases of the file are not of good quality.

    But, any how trim the first 4 bases, align and see.
    Do it. You will learn a lot by going.

    Best,
    Vishnu.

    Leave a comment:


  • persorrels
    replied
    Human, 10x exome. Total sequence size is about 30Gb. 100bp per read. Attached are some sample statistics from reverse reads.
    Attached Files

    Leave a comment:


  • dpryan
    replied
    You can usually use the default minimum size of whatever trimmer you're using as a guide. Often minimum sizes of 20 or 30 are used (I wouldn't bother going much lower than that, since anything shorter will probably just become a multi-mapper).

    Leave a comment:


  • vishnuamaram
    replied
    Hey persorrels,

    what is the organism you have sequenced, what is the coverage.

    how much is the data size. how many reads does your data have ?

    why are you seeing individual reads.

    Initially, you need to run a quality check on your entire reads together of Read1 and Read2 individually.
    then see the quality output chart, then proceed for trimming.

    Best,
    vishnu.

    Leave a comment:


  • persorrels
    replied
    Vishnu, thanks for your reply.

    It is true that most forward reads are of high quality. But the reverse reads aren't. Below are two examples:


    NTATATTTTCCTCTTGGTGGTATTGAAAACCAGTGAGCAGAGAGCATAAGAACAGAACTTCAAGACCGTGGCAGGAGCTTGTATTTGTACAGCACAAACCC
    +
    #+12??A;A>@>C>CBBBA=?CBBBBBBCBAAA@ABBBB>ABB;=BBBB<=A;=AA>==AAAB=>AAAA################################




    NAAGGAGCAGCTGCGTGCCGCGTGAGCTTTAGCAGGAGGACCAGTGATTAGCATTTACGATGCAAAGACAGAACAACTTCGTATAGGACTGTACCCCTGGA
    +
    #+1<?7AA<CBABBC<CCAAA=)?153*=A?A#####################################################################


    It is an extreme example, but you can recover a 18bp region (AA<CBABBC<CCAAA=) from the second read. I guess what you're saying is, if I had to trim a large portion of the read, I should ignore it entirely.

    Is that correct?

    Also, I suspect short reads like this will affect the performance of BWA. I want to understand how the read length distibution affects the performance of BWA.

    Any comments on that?

    Cheers,

    Per

    Leave a comment:


  • vishnuamaram
    replied
    Hey persorrels,

    It looks like your approach of trimming the bases and discarding reads is not appropriate.

    Illumina gives more or less good quality reads except at the 1st 3-4 base positions and may be at last 2 base positions.

    --> It doesnt make sense of getting reads of size 30,40,50 after trimming 100 bp size reads.

    --> Just be concerned about the first few bases quality, if they are above Q20, you may proceed with alignment. if not above Q20, just trim those bases, that will do.

    Good luck ahead,
    Vishnu.

    Leave a comment:


  • persorrels
    started a topic Minimum Read Length for BWA

    Minimum Read Length for BWA

    Hi all,

    I am preprocessing a dataset from a human sample sequenced by Illumina HiSeq 2500 (Paired-end reads, 100bp each). I first trim each read based on quality. If the trimmed sequence is too short, I just discard it.

    My question is how do you pick the threshold length to discard? Would you discard reads shorter than 50, 40, or 30? What is the right approach to pick a threshold?

    I haven't been able to find any information on this on the web. (By the way, I am using BWA for alignment.)

    Thanks in advance.
    Last edited by persorrels; 10-03-2013, 03:38 PM. Reason: Clarification

Latest Articles

Collapse

  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
20 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
30 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
17 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
34 views
0 reactions
Last Post SEQadmin2  
Working...