Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • danielecook
    Junior Member
    • Oct 2013
    • 8

    #1

    eland extended

    I've been given some 'eland extended' files to work with. There really isn't much online about these. I'm trying to convert them to sam/bam format or something more useful but I keep hitting dead ends. Does anyone know anything about this format, know what data is represented, and any tools for working with it?

    Thanks -
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    When you are referring to the "eland extended" files which exact files are you referring to?

    Do the file names have "s_*_eland_multi.txt" file names or are they called "s_*_eland_results.txt"?

    As I recall the "eland_extended" analysis referred to alignments done with sequences that were > 32 bp long (seems odd now but that was the state of the art in 2008) and should have resulted in files with "multi" in the name.

    Comment

    • danielecook
      Junior Member
      • Oct 2013
      • 8

      #3
      I suspect the names have changed - here is a sample of the file:

      >HWUSI-EAS107_0008:5:1:18780:1121#0/1 GTGGGGCAGTACCTCTCCTGCAGCTGTTGTTAGTGG 1:1:0 chr19.fa:16326479F30G2CA1,16326543F36
      >HWUSI-EAS107_0008:5:1:18802:1128#0/1 TGCCATAGCCTTCCCATGATGCATACTTAGCCTCAC 1:0:0 chr18.fa:24911372R36
      >HWUSI-EAS107_0008:5:1:18874:1125#0/1 AAACCCCCACAGTAACAACAGCTCCTCTGGCCCCAA 1:0:0 chr3.fa:130007959R35G
      >HWUSI-EAS107_0008:5:1:19029:1128#0/1 AGATTCCTTGACTGGTCTATTGACATTGGCATATTT 1:0:0 chr19.fa:49024613R36
      >HWUSI-EAS107_0008:5:1:19073:1118#0/1 TTACCATCCCCTCTATTAATCACATGGAACCTGATA 255:33:1 -
      >HWUSI-EAS107_0008:5:1:19096:1122#0/1 CATATGCCTTTAATCCCAGCACTTGGGAGGCAGAGG 148:255:255 -
      >HWUSI-EAS107_0008:5:1:19214:1128#0/1 TCAACACACAACTGTATGCTAATGTTCTGATTAATC 1:0:0 chr11.fa:3052382F32T3
      >HWUSI-EAS107_0008:5:1:19252:1121#0/1 CTGGCTAGGCAGTCTAGCCCAGTCTGTGAGATCCCG 1:0:0 chr3.fa:138169276F36
      >HWUSI-EAS107_0008:5:1:19319:1123#0/1 GGGCTGCTACTCTCACAGAGTCCTGGGGTGGTAGGG 1:0:0 chr11.fa:71607540R36
      >HWUSI-EAS107_0008:5:1:19357:1120#0/1 GGCCTTGAAGTGTTAGGTTGTTGGGTTAAAGACTTC NM -
      >HWUSI-EAS107_0008:5:1:19415:1126#0/1 ATGGACCCAACAGCCTTCCACACTACAGAAGGATGA 1:0:0 chr15.fa:86824347R36
      >HWUSI-EAS107_0008:5:1:19463:1119#0/1 GGGTGTGTTTTAGTTCACAATTCCAAGTTGTAGTCC 1:0:0 chr7.fa:114170220R36
      >HWUSI-EAS107_0008:5:1:19527:1128#0/1 TGGGGAGAGGGAAGAGGAATGGCAGCAAGGCACGCC 1:0:0 chr4.fa:114142946F36
      >HWUSI-EAS107_0008:5:1:19773:1128#0/1 AGATGCGGTCCCAGTATCAACTAGTTAGTATAGACA 1:0:0 chr7.fa:68841823R36
      The file name is simply ends in '.extended'

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Excerpt from your example:

        >HWUSI-EAS107_0008:5:1:19214:1128#0/1 TCAACACACAACTGTATGCTAATGTTCTGATTAATC 1:0:0 chr11.fa:3052382F32T3
        >HWUSI-EAS107_0008:5:1:19252:1121#0/1 CTGGCTAGGCAGTCTAGCCCAGTCTGTGAGATCCCG 1:0:0 chr3.fa:138169276F36
        >HWUSI-EAS107_0008:5:1:19319:1123#0/1 GGGCTGCTACTCTCACAGAGTCCTGGGGTGGTAGGG 1:0:0 chr11.fa:71607540R36
        >HWUSI-EAS107_0008:5:1:19357:1120#0/1 GGCCTTGAAGTGTTAGGTTGTTGGGTTAAAGACTTC NM -
        >HWUSI-EAS107_0008:5:1:19415:1126#0/1 ATGGACCCAACAGCCTTCCACACTACAGAAGGATGA 1:0:0 chr15.fa:86824347R36
        Description of the "eland_multi" format (your example looks slightly different in the "matches found" section):

        1. Sequence name
        2. Sequence
        3. Either NM, QC, RM or the following:

        • NM—No match found
        • QC—No matching done: QC failure (too many Ns)
        • RM—No matching done: repeat masked (may be seen if repeatFile.txt was
        specified)
        • U0—Best match found was a unique exact match
        • U1—Best match found was a unique 1-error match
        • U2—Best match found was a unique 2-error match
        • R0—Multiple exact matches found
        • R1—Multiple 1-error matches found, no exact matches
        • R2—Multiple 2-error matches found, no exact or 1-error matches

        4. x:y:z where x, y, and z are the number of exact, single-error, and 2-error matches
        found
        5. Matches found (Blank, if no matches found): e.g. BAC_plus_vector.fa:163022R1,170128F2,E_coli.fa:3909847R1
        This says there are two matches to BAC_plus_vector.fa: one in the reverse direction starting at position 160322 with one error, one in the forward direction starting at position 170128 with two errors. There is also a single-error match to E_coli.fa [Note: Your example looks different in this section, otherwise the format seems to align well]

        Problem is you do not have information about the quality values in this file (there should be a corresponding s_*_sequence.txt file in fastq format). Is there a chance you can get that?

        Comment

        • danielecook
          Junior Member
          • Oct 2013
          • 8

          #5
          Unfortunately - this is the only file I was given to work with. I guess the quality scores were truncated before I got to this? Not sure...

          Thanks for your help. Do you know if there are any tools out there for working with this?

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142

            #6
            "Eland_multi.txt" files never had the quality scores in them. Those would be included in corresponding "s_*_export.txt or s_*_sorted.txt" files (I will assume that those are unavailable).

            At a minimum you can create a multi-fasta sequence file (from the file you have). Not having the quality values would make it tough to judge quality of the basecalls.

            Ultimately what are you trying to do with this data?
            Last edited by GenoMax; 10-16-2013, 12:01 PM.

            Comment

            • danielecook
              Junior Member
              • Oct 2013
              • 8

              #7
              This was a project that was passed on to me. It's a ChIP-seq experiment. We are hoping to compare our data against another groups ChIP-seq work which was comparable but in a different cell line. We used Illuminas pipeline to align (which used Eland) and the other group used Bowtie. I doubt I would be able to go back and obtain the fasta/fastq files.

              The previous people that worked on this project used this script to converts this file to bed format. Any reads with multiple alignments, and any mismatches are excluded. I will check back and see if I can find out if any other filtering happened prior to me getting this file (I am certainly hoping that is the case!).

              Using the script I was able to produce a bed file and use bedtools to convert to bam.

              I have bowtie native files from the other group - which I was able to successfully convert to bam as well - so now everything is in bam format.

              Thanks again for your help. Any ideas/concerns/comments are greatly appreciated.

              Comment

              • GenoMax
                Senior Member
                • Feb 2008
                • 7142

                #8
                Hopefully the mapping was done against the same build of the genome in both cases. Otherwise the comparisons may not be valid.

                Since you mentioned ChIP-seq there is USeq: http://useq.sourceforge.net/ which also has a parser for eland_multi files: http://useq.sourceforge.net/applications.html

                Comment

                • danielecook
                  Junior Member
                  • Oct 2013
                  • 8

                  #9
                  Yeah - I am taking care to verify that things look correct in IGV as far as build is concerned. The past folks were confident its mm9. I will for sure look into useq. Greatly appreciate all your help! I am relatively new but very eager to learn.

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                    by SEQadmin2



                    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                    Despite this, “CRISPR helped turn genome editing from a specialized technique into
                    ...
                    07-31-2026, 11:01 AM
                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 08-06-2026, 07:41 AM
                  0 responses
                  16 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-03-2026, 10:13 AM
                  0 responses
                  31 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-31-2026, 02:55 AM
                  0 responses
                  42 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-24-2026, 12:17 PM
                  0 responses
                  26 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...