Trimmomatic error reading Fastq files

lkazen

Junior Member

Join Date: Oct 2024

Posts: 1
- Share
- Tweet
#1

Trimmomatic error reading Fastq files

10-12-2024, 09:29 AM

I'm trying to run Trimmomatic on some shotgun sequencing paired end files and while most of them are working (so I know the code isn't the problem), a handful of files are unable to be run. I ran this code:

java -jar /scratch/g/jkirby/trimmomatic-0.39/trimmomatic-0.39.jar PE /scratch/g/jkirby/Landon_WGS_reanalysis/Figure_8/00_RAW_sequences/LTH2584Risp_108_R1.fastq.gz /scratch/g/jkirby/Landon_WGS_reanalysis/Figure_8/00_RAW_sequences/LTH2584Risp_108_R2.fastq.gz /scratch/g/jkirby/Landon_WGS_reanalysis/mouse_removal/LTH2584Risp_108_trimmed_R1.fastq.gz /scratch/g/jkirby/Landon_WGS_reanalysis/mouse_removal/LTH2584Risp_108_untrimmed_R1.fastq.gz /scratch/g/jkirby/Landon_WGS_reanalysis/mouse_removal/LTH2584Risp_108_trimmed_R2.fastq.gz /scratch/g/jkirby/Landon_WGS_reanalysis/mouse_removal/LTH2584Risp_108_untrimmed_R2.fastq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10:2:True LEADING:3 TRAILING:3 MINLEN:36

And keep getting this error from Trimmomatic: Exception in thread "main" java.lang.RuntimeException: Invalid FASTQ name line: followed by a bunch of dark symbols with question marks inside for several hundred (or possibly several thousand) lines.

A second file resulted in a similar error but the problematic line was completely different:

Exception in thread "main" java.lang.RuntimeException: Invalid FASTQ comment line: GCCTCAGCTCCGGGATGTGCTTCATCAGATGGATAAAGGAATTTAGCCAAAGGCTACTTTTGTGGTGAACAGCGGGACAGGGTTGCATTTGAATTATGTCCAGACTCAGCCGGTTCCCATCTACACGCAGAACCAGCACTATCTGAAGGAG

Clearly the error is with the fastq files but I'm not sure if there's a way to fix them?

Last edited by lkazen; 10-12-2024, 09:33 AM.
Tags: bioinformatics, fastq files, metagenomics, trimmomatic error, trimmomatic problem

Previous template Next

From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data

by SEQadmin2

Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...
- Channel: Articles
06-02-2026, 10:05 AM
Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends

by SEQadmin2

With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.

Introduction

Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
- Channel: Articles
05-22-2026, 06:42 AM

Topics	Statistics	Last Post
Sequencing the Two-Toed Sloth Genome Reveals Jumping Genes Tied to Its Extreme Metabolism by SEQadmin2 Started by SEQadmin2, 06-09-2026, 11:58 AM	0 responses 24 views 0 reactions	Last Post by SEQadmin2 06-09-2026, 11:58 AM
A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2 Started by SEQadmin2, 06-05-2026, 10:09 AM	0 responses 29 views 0 reactions	Last Post by SEQadmin2 06-05-2026, 10:09 AM
A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2 Started by SEQadmin2, 06-04-2026, 08:59 AM	0 responses 39 views 0 reactions	Last Post by SEQadmin2 06-04-2026, 08:59 AM
Long-Read RNA Sequencing Uncovers a Hidden Layer of Immune Cell Regulation by SEQadmin2 Started by SEQadmin2, 06-02-2026, 12:03 PM	0 responses 61 views 0 reactions	Last Post by SEQadmin2 06-02-2026, 12:03 PM

Unconfigured Ad

Trimmomatic error reading Fastq files

Latest Articles

ad_right_rmr

News