Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • balthasar
    Junior Member
    • Oct 2014
    • 5

    bam-readcount warning

    hi everybody,

    i am using bam-readcount to filter out false positives from snp calling.

    i am getting (sometimes almost 5million) warnings like:
    WARNING: In read XXX_XXX_XXX: Couldn't find single-end mapping quality. Check to see if the SM tag is in BAM.

    what does it exactly mean?
    (please find an example read pair below)

    as you can see from the example, both reads have a proper mapq field, so,
    1.) where is the problem?
    2.) why does it need the sm tag?
    3.) why is there no problem with most of the other reads?

    thanks so much for any advice! chris

    here is one of the read pairs,
    XXX_XXX_XXX 99 1 565899 21 50M = 565967 68 CTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAA `````````````````````````````````````````````````A XA:i:3 MD:Z:2G35T11 XE:Z:-------------------------------------------------- PG:Z:bfast IH:i:1 NH:i:2 HI:i:1 CM:i:0 NM:i:2 CQ:Z:A<A=;>BBB<@>BB@ABBABAAAB?BBABB@BBB?BBA<BBBB@ABBBBA MQ:i:28 AS:i:2100 CS:Z:T22313302303223122011022103211112312200013332230110 RG:Z:4

    XXX_XXX_XXX 147 1 565967 28 35M = 565899 -68 GTTTGAACACACAACACCCACCCCATTCCTCCCCA 2HNN""1`\SUX^`M9O````````````\````` XA:i:3 MD:Z:14A20 XE:Z:----11----------------------------- PG:Z:bfast IH:i:1 NH:i:2 HI:i:1 CM:i:2 NM:i:1 CQ:Z:@ABBB<7B?;@=BB=:BBA%+9@5:28;B21-8-2 MQ:i:21 AS:i:1300 CS:Z:T01000220203100011001110111111111001 RG:Z:4
  • balthasar
    Junior Member
    • Oct 2014
    • 5

    #2
    just in case anyone is interested:

    BWA-MEM 0.7.4 does not output single-end mapping qualities. Running bam-readcount results in millions (one per read) of warnings. Please emit one warning and suppress all following warnings. Couldn...

    Comment

    Latest Articles

    Collapse

    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-02-2026, 11:08 AM
    0 responses
    25 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-26-2026, 11:10 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-17-2026, 06:09 AM
    0 responses
    55 views
    0 reactions
    Last Post SEQadmin2  
    Working...