Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Iris Cristata
    Junior Member
    • Mar 2010
    • 2

    About Mosaik Assembler Consensus String

    Hello everybody,

    I just want to know how I can get a consensus string from the output of mosaik .ace file.

    If that's impossible, is there any other way to get the consensus string?

    Thanks
  • flxlex
    Moderator
    • Nov 2008
    • 412

    #2
    Unless I am mistaken or misunderstand your question, the ace file begins with the consensus, or rather, each contig entry in the ace file begins with the consensus, for example:

    Code:
    AS    8364 763600  
    
    CO contig00001 152567 9338 3216 U
    AgTTTTTg*TCAa*gCCGAAACCCGTAA*TCACAAAGGCTTTTTtGTGAA
    ACAAGgAGCCTATAaGTTAAAAAaTA*TTGATGAATCGGGTTGGGCTTTA
    ATCTGTG*TTGATG*A*CACCGTTTGTTATTACGTTGATCCCGATAATTT
    .... etc
    Just remove the '*' symbols (gaps introduced for optimizing alignemtn) and you're there.

    Comment

    • Iris Cristata
      Junior Member
      • Mar 2010
      • 2

      #3
      Thanks, maybe I have interpreted consensus wrong, but what I want is, if at certain bp the reads are different from the reference, I want the reads bp, instead of the reference.

      I ran a simple test assembly using Mosaik 1.0.1388, and the ace file looks like:

      Code:
      AS 1 3
      
      CO test 50 3 1 U
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      
      BQ ......
      
      AF .MosaikReference U 1
      AF read2 U 1
      AF read1 U 2
      BS 1 50 .MosaikReference
      
      RD .MosaikReference 50 0 0
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      
      RD read2 49 0 0
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTT
      
      RD read1 49 0 0
      ATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      In this run, the consensus is identical to the reference at the red bp, i.e. T, but I wanted it to be G, like in the reads.
      Last edited by Iris Cristata; 07-04-2010, 07:00 PM.

      Comment

      • sklages
        Senior Member
        • May 2008
        • 628

        #4
        There is no simple way to get the consensus from an ACE file, simply because it's not in there.
        The CO tags represent the COntig sequences, what is usually the reference sequence in
        mapping approaches.

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Cancer Drug Resistance: The Lingering Barrier to Rising Survival
          by SEQadmin2



          Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

          There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
          Today, 05:17 AM
        • GATTACAT
          Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
          by GATTACAT
          Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
          07-01-2026, 11:43 AM
        • SEQadmin2
          Nine Things a Sample Prep Scientist Thinks About Before Sequencing
          by SEQadmin2


          I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

          Here are nine questions we think about, in roughly the order they matter, before...
          06-18-2026, 07:11 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, Today, 10:08 AM
        0 responses
        5 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, Yesterday, 11:05 AM
        0 responses
        7 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-02-2026, 11:08 AM
        0 responses
        29 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-30-2026, 05:37 AM
        0 responses
        28 views
        0 reactions
        Last Post SEQadmin2  
        Working...