[Xi Wang]

Dear all,

I am quite intrigued with Bowtie and the options it offers.
When trying to figure out the best settings for my application, the following question arose:

According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

Many thanks for your comments!
Sophia

I think it's hard for bowtie to combine best single end alignment. Also it's hard to define the best alignment for paired-end reads.

[sdvie]

best alignment for paired-end reads

Dear all,

I am quite intrigued with Bowtie and the options it offers.
When trying to figure out the best settings for my application, the following question arose:

According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

Many thanks for your comments!
Sophia

[axiom7]

Disparate results between -m1 and -a

Hi,

I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand what bowtie is doing, as the researcher is really only interested in unique pairs.

When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m. The reads that align are numbers 1,3,4,5,7,8,9.

However when I run bowtie with -a --ff -v0 -y, bowtie reports that all 10 reads align and in addition, it shows multiple alignments for reads 1 and 8.

Two things don't make sense to me:

1. Why does bowtie say that one read does not align at all when I specify -m1 and then report alignments for all 10 pairs when I specify -a?

2. Why does bowtie report reads for pairs 1 and 8 for the -m1 run, when it shows multiple alignments for those pairs when I specify -a?

Of course all runs specify -I700 -X1300.

Thanks.
Susan

[genetic]

Usual workstation OK?

Hi all,
I have tried running Bowtie on a PC with 300 GB disc, 2.66 GHz, 1.98 GB RAM. It says "out of memory allocating [ebwt] array for the Bowtie index".
I want to map using the human hg18 genome. Are there some hints to run it on such PC or I really need more memory?
Thanks.

[James]

Index problem

Hi,

I've been using an index I created for a while now and just realized that the index is only for about half of the fastq file I wanted.

So I carried out bowtie-inspect and I get this:

bowtie-inspect -s indexes/cds
Colorspace 0
SA-Sample 1 in 32
FTab-Chars 10
assert_eq: expected (5320, 0x14c8) got (2526, 0x9de)
bowtie_inspect.cpp:218
Assertion failed: (0), function print_index_summary, file bowtie_inspect.cpp, line 218.
Abort trap


I have no idea how to go about fixing this. So any help would be much appreciated.

Thanks, J

Edit: I Fixed this by splitting up the FASTA file and building multiple indexes.

[Xi Wang]

I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.

You may use the option:

-5/--trim5 <int> trim <int> bases from 5' (left) end of reads

such as "-5 1"

[laghs]

I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.

I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.

[Xi Wang]

I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
# reads processed: 1
# reads with at least one reported alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments


../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments to 1 output stream(s)

I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.

[laghs]

Missed alignment?

I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
# reads processed: 1
# reads with at least one reported alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments


../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments to 1 output stream(s)

[didymos]

For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.

Thank you!
very clear presentation. However in my case things are little bit different.
I am mapping not to the whole genome but only to the miRNA sequences (previously indexed with bowtie-build). If I understand correctly color is identified as color error when after correction sequence can be easily mapped, but in my case this "error" sequence can be just not a miRNA sequence - other RNA type from RNA-seq experiment.
Question is how many color errors are allowed to be correct in bowtie - how I can set it or how can I switch it off if possible?
Thanks!

tomek

[nilshomer]

Hi,
I have another question about solid data...:
I have two different reads:
T32221113212031121021022123023302010
and
T22221113212031121021022123023302010
In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

Why?
Thanks for any suggestions!
Best!

tomek

For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.

[didymos]

bowtie and solid

Hi,
I have another question about solid data...:
I have two different reads:
T32221113212031121021022123023302010
and
T22221113212031121021022123023302010
In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

Why?
Thanks for any suggestions!
Best!

tomek

[yeb3czg]

Xi
I tried it didn't change anything but I found what was the problem in one of my reads file the format of one lane was not correct
now it 's working
thanks

[Xi Wang]

Hi all

I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
>bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

but I got the message
"Reads file contained a pattern with more than 1024 sequence characters.
Please truncate reads and quality values and and re-run Bowtie
terminate called after throwing an instance of 'int'
Aborted"

but if I'm using one file of the paired end reads as single end for alignment it works

There is no uncalled bases in my reads
Any idea about this issue ?

Thank you

AC

Have you try to put the option -m ahead, like this?

bowtie  -m 1 -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt > xx.sam

[yeb3czg]

Hi all

I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
>bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

but I got the message
"Reads file contained a pattern with more than 1024 sequence characters.
Please truncate reads and quality values and and re-run Bowtie
terminate called after throwing an instance of 'int'
Aborted"

but if I'm using one file of the paired end reads as single end for alignment it works

There is no uncalled bases in my reads
Any idea about this issue ?

Thank you

AC