Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • cp229
    replied
    I think I`ve got that now!!Thank you very much Xi Wang.

    Leave a comment:


  • didymos
    replied
    Originally posted by Ben Langmead View Post
    I think the problem is that you're assuming -n 0 -l 16 is going to allow any alignment with no mismatches in the first 16 colors, but the -e limit also applies. -e also needs to be set high enough so that the sum of the quality values of all the mismatched positions in your example are still <= the -e limit. If no quality values are supplied, qualities all = 30.

    Hope that helps. You may also want to consider using trimming (e.g. -3).

    Thanks,
    Ben
    Thank you Ben! and sorry for late response...
    Now it works as I want
    Best!

    tomek

    Leave a comment:


  • Subho
    replied
    Is it possible to get mapping quality and read quality (a single value per read, e.g. calculated out of base quality) for Bowtie?

    Leave a comment:


  • Xi Wang
    replied
    Originally posted by cp229 View Post
    Hi Ben, I am a very new beginner with bowtie. I have a question about it, hope you can help me out. When I run bowtie with 454 long reads(the read length is about 200bp), the result is very weird that nearly 98% of reads are mismatching. (I tried human, yeast and e_coli). Could you tell me that whether I can use bowtie to align the long read or not....Thx
    The 454 reads may contain indel errors while sequencing. Also, longer reads may cover more indel variants in the reference genome. I think the indels could be the main reason why bowtie reported a low mappable ratio.

    Leave a comment:


  • cp229
    replied
    Hi Ben, I am a very new beginner with bowtie. I have a question about it, hope you can help me out. When I run bowtie with 454 long reads(the read length is about 200bp), the result is very weird that nearly 98% of reads are mismatching. (I tried human, yeast and e_coli). Could you tell me that whether I can use bowtie to align the long read or not....Thx

    Leave a comment:


  • skblazer
    replied
    Hi, Ben Langmead
    Recently I used bowtie to align some solexa reads in 100bp length. But the matched ratio is low. I want to know what's your recommendation for the option parameters for the long reads such as 100bp?

    Thank you

    Leave a comment:


  • issaac
    replied
    calling variants with samtools after bowtie -- very long lines in output

    Hi,

    I am facing the following situation. It looks like there could be an error in my approach, but I am trying to figure out. I would much appreciate your inputs/suggestions to resolve my problem.

    1. (PROBLEM) I am trying to align PhiX-174 reads, obtained from GA IIx, on to the reference (from NCBI) using the bowtie program and then subsequently look for variants using samtools.

    I am getting very long lines in the final SNP calling output file and the result doesn't look meaningful.

    2. Illumina-analysis-software-generated fastq file, which I am using contains some 18 million read sequences.

    3. If needed, I can provide a truncated version of the output, as the output is 366M in size.

    4. To check the Bowtie installation on my computer, I ran the example provided in the Bowtie: Tutorial section, especially, Finding variations with samtools -- the run was successful.

    I performed the following steps:

    STEP #1: Generate Indexes for the PhiX-174 genome
    bowtie-build phix174.fasta phix174

    STEP #2: Perform alignment with bowtie and generate sam file
    bowtie -S phix174 phix174.fastq phix174.sam

    STEP #3: Convert sam to bam file
    samtools view -bS -o phix174.bam phix174.sam

    STEP #4: Sort the bam file in preparation for SNP calling
    samtools sort phix174.bam phix174.sorted

    STEP #5: Identify SNPs...
    samtools pileup -cv -f phix174.fasta phix174.sorted.bam > phix174.variants

    Thanks,
    Issaac

    Leave a comment:


  • afadda
    replied
    Originally posted by Ben Langmead View Post
    bowtie view? I'm confused - can you send the exact command you're using?

    Thanks,
    Ben
    sorry!! I actually meant samtools view. perhaps this is not the right string for my problem.
    thanks

    Leave a comment:


  • Ben Langmead
    replied
    Originally posted by didymos View Post
    However in my reads from SOLiD I have reads of length 35 so this miRNA is longer and is:
    T31210212010221212202033002010303111
    but first 23 "numbers" are the same so using this option:
    bowtie -a -n 0 -l 16 -C ../mouse/miRNA-stem-loop -c T31210212010221212202033002010303111
    I should be able to map this read, but it does not work like this:
    # reads processed: 1
    # reads with at least one reported alignment: 0 (0.00%)
    # reads that failed to align: 1 (100.00%)
    No alignments

    and I have no idea why...
    Thank you for any sugestions!
    I think the problem is that you're assuming -n 0 -l 16 is going to allow any alignment with no mismatches in the first 16 colors, but the -e limit also applies. -e also needs to be set high enough so that the sum of the quality values of all the mismatched positions in your example are still <= the -e limit. If no quality values are supplied, qualities all = 30.

    Hope that helps. You may also want to consider using trimming (e.g. -3).

    Thanks,
    Ben

    Leave a comment:


  • Ben Langmead
    replied
    bowtie view? I'm confused - can you send the exact command you're using?

    Thanks,
    Ben

    Originally posted by afadda View Post
    hi. i get segmentation fault only when I run bwotie view on a certain data. it always stops at the same genome coordinates, whether it's in one big file with all chromosomes in, or just a file of that particular chromosome. can't tell what the problem is. help!!

    Leave a comment:


  • afadda
    replied
    hi. i get segmentation fault only when I run bwotie view on a certain data. it always stops at the same genome coordinates, whether it's in one big file with all chromosomes in, or just a file of that particular chromosome. can't tell what the problem is. help!!

    Leave a comment:


  • didymos
    replied
    problem with SOLiD data mapping

    Hi,
    I am trying to map short reads from SOLiD into indexes generated from stem-loop sequences of miRs to get information about miRNA in my samples.
    Indexes I have generated from fasta file (from miRBASE) by bowtie-build -C and it works great. However I have some problem with mapping... I will explain it with example:
    mmu mir-378 -> ACTGGACTTGGAGTCAGAAGG
    when I have converted it into colorspece (with T at the begining - from promotor) I got:
    T312102120102212122020
    Mapping this miRNA works great:
    bowtie -a -n 0 -C ../mouse/miRNA-stem-loop -c T312102120102212122020

    0 + mmT-mir-378 43 CTGGACTTGGAGTCAGAAG qqqqqqqqqqqqqqqqqqq 0


    However in my reads from SOLiD I have reads of length 35 so this miRNA is longer and is:
    T31210212010221212202033002010303111
    but first 23 "numbers" are the same so using this option:
    bowtie -a -n 0 -l 16 -C ../mouse/miRNA-stem-loop -c T31210212010221212202033002010303111
    I should be able to map this read, but it does not work like this:
    # reads processed: 1
    # reads with at least one reported alignment: 0 (0.00%)
    # reads that failed to align: 1 (100.00%)
    No alignments

    and I have no idea why...
    Thank you for any sugestions!
    Best

    tomek

    Leave a comment:


  • corthay
    replied
    Hi Ben,

    I appreciate your quick response.
    I think I understood it.

    Thanks,
    Corthay

    Leave a comment:


  • Ben Langmead
    replied
    Hi Corthay,

    Originally posted by corthay View Post
    I would like to ask about "-n" option. I would like to map read
    following conditions.
    1. first N bases must be perfect match.
    2. reported position must be 'best' hit.

    I used " -n 0 -l N -a --best --strata ". I am wondering if the '--best'
    option is only guaranteed "-n" and '-l' option. For example, I worry
    that bowtie reports 1 mismatch hit even if there is perfect hit.
    --best = best in terms of stratum first and quality second. It should report all 0-penalty alignments before any non-0 penalty alignments. So it should do what you want.

    Originally posted by corthay View Post
    Also, I would like to know the option to get random position if reads hit to multiple position.
    That's the default - you'll get that behavior if you omit the -a option.

    Thanks,
    Ben

    Leave a comment:


  • corthay
    replied
    Question abou &quot;-n&quot; option.

    Hi,

    I would like to ask about "-n" option. I would like to map read
    following conditions.
    1. first N bases must be perfect match.
    2. reported position must be 'best' hit.

    I used " -n 0 -l N -a --best --strata ". I am wondering if the '--best'
    option is only guaranteed "-n" and '-l' option. For example, I worry
    that bowtie reports 1 mismatch hit even if there is perfect hit.

    Also, I would like to know the option to get random position
    if reads hit to multiple position.

    Thanks,
    Corthay.

    Leave a comment:

Latest Articles

Collapse

  • SEQadmin2
    New Genomics Technologies Take Aim at Long-Standing Limits
    by SEQadmin2


    Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

    We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
    ...
    09-28-2026, 10:25 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 09-29-2026, 09:51 AM
0 responses
26 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-25-2026, 09:06 AM
0 responses
44 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-23-2026, 11:05 AM
0 responses
33 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-18-2026, 11:37 AM
1 response
51 views
0 reactions
Last Post pekgio
by pekgio
 
Working...