Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • alig
    Member
    • Sep 2008
    • 44

    Maq problems getting started

    I have downloaded Maq & am trying to get the program to work.
    When I try to run Maq I get this output

    maq.pl demo ref.fasta calib-36.dat
    -- CMD: mkdir -p maqdemo
    -- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
    calib-30.dat > maqdemo/true.snp
    > > /usr/bin/maq: line 1: .": command not found
    > > /usr/bin/maq: line 2: .": command not found
    > > /usr/bin/maq: line 3: .": command not found
    > > /usr/bin/maq: line 4: .": command not found
    > > /usr/bin/maq: line 5: .de: command not found
    > > /usr/bin/maq: line 6: .br: command not found
    > > /usr/bin/maq: line 7: .if: command not found
    > > /usr/bin/maq: line 8: .ne: command not found
    > > /usr/bin/maq: line 9: .PP: command not found
    > > /usr/bin/maq: line 10: fB\simulatefR: command not found
    > > /usr/bin/maq: line 11: .PP: command not found
    > > /usr/bin/maq: line 12: ..: command not found
    > > /usr/bin/maq: line 13: syntax error near unexpected token `('
    > > /usr/bin/maq: line 13: `.de Sp \" Vertical space (when we can't use .PP)'
    > > ** fail to run command '/usr/bin/maq simulate -N 1000000 maqdemo/r1.fq
    > > maqdemo/r2.fq ref.fasta calib-30.dat > maqdemo/true.snp' at /usr/bin/
    > > maq.pl line 842.


    If I try to run maq.pl easyrun -d outdir ref.fasta reads.fastq command I get

    -- CMD: /usr/bin/maq fasta2bfa
    /Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
    /dev/null
    ** fail to run command '/usr/bin/maq fasta2bfa
    /Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
    /dev/null' at /usr/bin/maq.pl line 842.

    I save my ref.fasta file in Bbedit as Unix format. I'm not a bioinformatician
    so am struggling.

    any help would be greatly appreciated

    alig
  • ECO
    --Site Admin--
    • Oct 2007
    • 1360

    #2
    Hey Alig,

    here is the output from that command when it's running correctly:

    Code:
    [SIZE=1]eco@******:~/perl/maq$ maq.pl demo testref.fa calib-36.dat 
    -- CMD: mkdir -p maqdemo
    -- CMD: /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq testref.fa calib-36.dat > maqdemo/true.snp
    -- 1 sequences, total length: 312
    -- CMD: /usr/local/bin/maq fasta2bfa testref.fa maqdemo/ref.bfa
    -- 1 sequences have been converted.
    -- CMD: (cd maqdemo; /usr/local/bin/maq.pl easyrun -p -d easyrun ref.bfa r1.fq r2.fq)
    -- CMD: ln -sf /Users/eco/perl/maq/maqdemo/ref.bfa easyrun/ref.bfa
    -- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /Users/eco/perl/maq/maqdemo/r1.fq easyrun/read1
    -- finish writing file 'easyrun/[email protected]'
    -- 1000000 sequences were loaded.
    -- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /Users/eco/perl/maq/maqdemo/r2.fq easyrun/read2
    -- finish writing file 'easyrun/[email protected]'
    -- 1000000 sequences were loaded.
    -- CMD: (cd easyrun; /usr/local/bin/maq map  -n 2 -e 70 [email protected] ref.bfa [email protected] [email protected] 2> [email protected])
    -- CMD: (cd easyrun; mv [email protected] all.map)
    -- CMD: (cd easyrun; /usr/local/bin/maq mapcheck ref.bfa all.map > mapcheck.txt)
    [ma_mapcheck] processing refernces...
    -- CMD: (cd easyrun; /usr/local/bin/maq assemble -N 2 -Q 60 consensus.cns ref.bfa all.map 2> assemble.log)
    -- CMD: /usr/local/bin/maq cns2fq easyrun/consensus.cns > easyrun/cns.fq
    -- CMD: /usr/local/bin/maq cns2snp easyrun/consensus.cns > easyrun/cns.snp
    -- CMD: /usr/local/bin/maq cns2win easyrun/consensus.cns > easyrun/cns.win
    -- CMD: /usr/local/bin/maq indelsoa easyrun/ref.bfa easyrun/all.map > easyrun/cns.indelse
    -- CMD: /usr/local/bin/maq indelpe easyrun/ref.bfa easyrun/all.map > easyrun/cns.indelpe
    -- CMD: /usr/local/bin/maq.pl SNPfilter -q 40 -w 5 -N 2 -f easyrun/cns.indelse -F easyrun/cns.indelpe -d 3 -D 256 -n 20 -Q60 easyrun/cns.snp > easyrun/cns.final.snp
    -- 0 potential soa-indels pass the filter.
    -- 0 potential pe-indels pass the filter.
    -- CMD: (cd easyrun; ln -s cns.final.snp cns.filter.snp)
    -- CMD: /usr/local/bin/maq.pl statmap easyrun/*.map.log
    
    -- == statmap report ==
    
    -- # single end (SE) reads: 0
    -- # mapped SE reads: 0 (/ 0 = NA%)
    -- # paired end (PE) reads: 2000000
    -- # mapped PE reads: 2000000 (/ 2000000 = 100%)
    -- # reads that are mapped in pairs: 1999942 (/ 2000000 = 99.99%)
    -- # Q>=30 reads that are moved to meet mate-pair requirement: 0 (/ 1999942 = 0%)
    -- # Q<30 reads that are moved to meet mate-pair requirement: 0 (0%)
    
    -- CMD: (cd maqdemo; /usr/local/bin/maq simustat easyrun/all.map > eval.simustat)
    -- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl sub -p eval.sub true.snp true.snp easyrun/cns.filter.snp)
    -- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl indelpe true.snp easyrun/cns.indelpe > eval.indelpe)
    -- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl indelsoa true.snp easyrun/cns.indelse > eval.indelse)
    ++ maqdemo/easyrun/cns.filter.snp gives the SNPs that passes most of filters.
    ++ maqdemo/easyrun/cns.final.snp is the high-quality subset of the previous SNPs.
    ++ maqdemo/easyrun/mapcheck.txt gives some statistics about qualities.
    ++ maqdemo/true.snp contains all variants used in simulation.
    ++ maqdemo/eval.* give various benchmarks. Their formats will be documented later.[/SIZE]
    First, I assume you did indeed download maq-data (the calib-36.dat file), here is the output when that file isn't there.

    Code:
    [SIZE=1]-- CMD: mkdir -p maqdemo
    -- CMD: /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp
    [maq_simulate] cannot open parameter file 'calib-36.dat'
    Assertion failed: (fpout1 && fpout2 && fp_fa && fp_par), function maq_simulate, file simulate.c, line 365.
    sh: line 1:  5836 Abort trap              /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp
    ** fail to run command '/usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp' at /usr/local/bin/maq.pl line 842.[/SIZE]
    Second, I would recreate a small reference from scratch (I just did what you describe with bbedit and it works fine). Could be either non-printing characters (bad line endings), or a strange character in the name definition line. Post up the header and first few lines.

    Last, have you checked that all the scripts are in either the same directory or your path (maq.pl, and maq_eval.pl, should both work standalone).

    Comment

    • ECO
      --Site Admin--
      • Oct 2007
      • 1360

      #3
      Just noticed this...something is wrong with either your data file or your version of maq.pl. See bolded region in your error message below (and compare to my successful run above)...it's launching with the wrong filename for the .dat file...

      My hints above were with 0.6.8. The only version I've found where most things work well for me.

      Originally posted by alig View Post
      I have downloaded Maq & am trying to get the program to work.
      When I try to run Maq I get this output

      maq.pl demo ref.fasta calib-36.dat
      -- CMD: mkdir -p maqdemo
      -- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
      calib-30.dat > maqdemo/true.snp
      > > /usr/bin/maq: line 1: .": command not found
      > > /usr/bin/maq: line 2: .": command not found
      > > /usr/bin/maq: line 3: .": command not found
      > > /usr/bin/maq: line 4: .": command not found
      > > /usr/bin/maq: line 5: .de: command not found
      > > /usr/bin/maq: line 6: .br: command not found
      > > /usr/bin/maq: line 7: .if: command not found
      > > /usr/bin/maq: line 8: .ne: command not found
      > > /usr/bin/maq: line 9: .PP: command not found
      > > /usr/bin/maq: line 10: fB\simulatefR: command not found
      > > /usr/bin/maq: line 11: .PP: command not found
      > > /usr/bin/maq: line 12: ..: command not found
      > > /usr/bin/maq: line 13: syntax error near unexpected token `('
      > > /usr/bin/maq: line 13: `.de Sp \" Vertical space (when we can't use .PP)'
      > > ** fail to run command '/usr/bin/maq simulate -N 1000000 maqdemo/r1.fq
      > > maqdemo/r2.fq ref.fasta calib-30.dat > maqdemo/true.snp' at /usr/bin/
      > > maq.pl line 842.


      If I try to run maq.pl easyrun -d outdir ref.fasta reads.fastq command I get

      -- CMD: /usr/bin/maq fasta2bfa
      /Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
      /dev/null
      ** fail to run command '/usr/bin/maq fasta2bfa
      /Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
      /dev/null' at /usr/bin/maq.pl line 842.

      I save my ref.fasta file in Bbedit as Unix format. I'm not a bioinformatician
      so am struggling.

      any help would be greatly appreciated

      alig

      Comment

      • ECO
        --Site Admin--
        • Oct 2007
        • 1360

        #4
        last but not least I'm going to move this to the Bioinformatics forum to get more eyes on it.

        Comment

        • alig
          Member
          • Sep 2008
          • 44

          #5
          Hi Eco,

          Firstly thank you very much for your quick reply.

          I did download maq-data (calib-36.dat file) And very sorry for the confusion but I just cut & pasted the output from an email I sent to Heng Li who said I was using the wrong .dat file (calib-30.dat) for maq-0.7.0. But using calib-36.dat made no difference to the output.

          This is the first few lines of my ref. fasta file
          >Salmonella typhi 45kb
          aaggaatttttttgactgggtccgggagacgtacctaaaatttaacaattcttggggagg
          tggctgggaaaatgaggtgccccaaataatcccgatgatgaatgatgaaggattgctgga
          gtgcccattttgcggttcgctgaaggtttacctgttcgacgagttggttttatctcatgg
          gtcttgctcgtcatgcgatgcgcgcacagatgaccactttgatgcttctatggctgtgaa
          gtcatggaacacccgcaacgggcacgtctacaccgctgacgacttcagtcgggcagcaga

          all the scripts are in the same usr/bin directory.

          But I did have to rename the maq.1 script to maq & am assuming that it is an executable.

          alig

          Comment

          • ECO
            --Site Admin--
            • Oct 2007
            • 1360

            #6
            Hrm. I had nothing but problems with 0.7.0 and 0.7.1, so went back to 0.6.8.

            Not sure why you renamed that script...maq.1 looks like the man pages for the program. That's undoubtedly your problem there...it's trying to execute whatever markup is used for man pages.

            Did you compile maq?

            Comment

            • xuer
              Member
              • Sep 2008
              • 17

              #7
              maybe you have fixed the froblem.if not,
              look the command below, are you using calib-30.dat or calib-36.dat?

              maybe it is the reason. if you can see the message soon.

              -- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
              calib-30.dat > maqdemo/true.snp

              Comment

              • alig
                Member
                • Sep 2008
                • 44

                #8
                maq problems

                I renamed the script...maq.1 as it was looking for maq in the same directory as maq.pl & maq_eval.pl & couldn't find maq as there wasn't a file of that name I assumed.

                That is probably my problem then if it is actually the man pages. I might try an earlier version then - 0.6.8

                thanks a lot for all your help so far everyone

                alig

                Comment

                • alig
                  Member
                  • Sep 2008
                  • 44

                  #9
                  Maq problems

                  I did compile maq, but I can never find a maq executable

                  The maq.pl & maq_eval.pl scripts come in maqview I think, & I have them

                  but there is only maq.1 not maq so I always get the ouput

                  maq.pl easyrun -d outdir ref.fasta reads.fastq
                  [gwhich] fail to find executable maq anywhere. at /usr/bin/maq.pl line 883.
                  ** Cannot find 'maq' executable. at /usr/bin/maq.pl line 77.

                  alig

                  Comment

                  • andpet
                    Member
                    • Jul 2008
                    • 27

                    #10
                    getting maq started

                    Hi,

                    the file maq.1 is definitly the man page, so it makes no sense to rename it to get the executable. The missing executable seems to be the problem

                    Maybe it is the best if you recompile your maq version (make clean first then ./configure; make; make install) and post any errors that occurred ?

                    Andreas

                    Comment

                    • valeu
                      Member
                      • Sep 2008
                      • 69

                      #11
                      Originally posted by ECO View Post
                      Hrm. I had nothing but problems with 0.7.0 and 0.7.1, so went back to 0.6.8.

                      Did you compile maq?
                      Oh thank you so much! I tried everything to make maq 0.7.1 work! I managed to compile it but then I got "Segmentation error" trying to run it..
                      And with 0.6.8 it's fine!

                      Valentina

                      Comment

                      • alig
                        Member
                        • Sep 2008
                        • 44

                        #12
                        Hi Andreas,

                        When I type 'make' I get this error message

                        /Documents/Alison/Maq/maq-0.6.8 jozefgecz$ make
                        cd . && /bin/sh /Users/jozefgecz/Documents/Alison/Maq/maq-0.6.8/missing --run autoheader
                        aclocal.m4:17: error: this file was generated for autoconf 2.61.
                        You have another version of autoconf. If you want to use that,
                        you should regenerate the build system entirely.
                        aclocal.m4:17: the top level
                        autom4te: /usr/bin/gm4 failed with exit status: 63
                        autoheader: /usr/bin/autom4te failed with exit status: 63
                        WARNING: `autoheader' is probably too old. You should only need it if
                        you modified `acconfig.h' or `configure.ac'. You might want
                        to install the `Autoconf' and `GNU m4' packages. Grab them
                        from any GNU archive site.

                        ......and at the very end - ld64-62.1 failed: symbol(s) not found
                        collect2: ld returned 1 exit status
                        make[1]: *** [maq] Error 1
                        make: *** [all] Error 2


                        I have downloaded & compiled autoconf 2.61 & GNU M4 1.4.9 but it still seems to be finding the built-ins (You have another version of autoconf) & not the newer version just installed.

                        alig

                        Comment

                        • ECO
                          --Site Admin--
                          • Oct 2007
                          • 1360

                          #13
                          Looks like that's a Mac...have you installed the developers tools ("Xcode" if i remember correctly) ??

                          Comment

                          • alig
                            Member
                            • Sep 2008
                            • 44

                            #14
                            Maq problems

                            Hi Eco,

                            Yes it's a Mac OS X 10.4.11 & so has Xcode 2.4.1 installed on it.

                            but the autoconf is only version 2.59 & gm4 is version 1.4.2

                            So I was trying to install more recent versions. But it's still looking at the built-ins & not the newer more recently installed versions

                            alig

                            Comment

                            • alig
                              Member
                              • Sep 2008
                              • 44

                              #15
                              Maq problems

                              I have just noticed this error when compiling maq-0.6.8 with 'make'

                              ld64 warning: in /usr/lib/libz.dylib, file is not of required architecture

                              I am running it on a PowerPC G4 Mac but also get the same error on a G5

                              even though the Maq webpage says that - "Compiling as a 32bit executable should work but the speed will be affected"

                              Do I just need to somehow get different libraries or should I just give up now !!!

                              exasperated alig

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-13-2026, 10:26 AM
                              0 responses
                              25 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              35 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              22 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              34 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...