Blast raw score calculation

[fungs]

Hello,

I know this sounds strange but I am having problems to validate the BLAST raw alignment scores (not the bit scores). Here an example alignment:

-------------------------------------------------------

Query: 100009 (Length=100)

Hit: NZ_ABBZ01004690 gi|153879981|ref|NZ_ABBZ01004690.1| Beggiatoa sp. PS, whole genome shotgun sequence
Length=280

Score = 176 bits (194), Expected = 6e-42
Identities = 99/100 (99%), Gaps = 0/100 (0%)
Strand=Plus/Minus

TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGCGTGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGTGTGA

-------------------------------------------------------

My scoring matrix is:
match: 2
mismatch: -3
gap open: 5
gap extension: 2

Following the formula from the NCBI web site http://www.ncbi.nlm.nih.gov/Educatio...t_Scores2.html (and what other aligners produce as raw score) this makes

99*2 - 3 = 195 and not 194 like BLAST says:

<Hsp_num>1</Hsp_num>
<Hsp_bit-score>176.213077892943</Hsp_bit-score>
<Hsp_score>194</Hsp_score>
<Hsp_evalue>6.28580662796915e-42</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>100</Hsp_query-to>
<Hsp_hit-from>108</Hsp_hit-from>
<Hsp_hit-to>9</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>99</Hsp_identity>
<Hsp_positive>99</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>100</Hsp_align-len>

In fact I noticed that all BLAST raw scores are even! I am using BLAST version 2.2.22+. Do I miss an import point here?

[robs]

Did you try to use BLAST+ instead? If the problem does occur with BLAST+, I would switch. You might also want to update to the latest BLAST version.

[fungs]

Yes, I am using BLAST+. I am currently running the latest version to see whether it makes any difference. Anyhow, this shoudn't be if it is really a bug. I couldn't find anything about it in the change logs from 2.2.22+ to 2.2.24+ so I rather think that it will give the same results with the latest version. What do you mean by "you should switch"?

[robs]

If the raw score is a huge issue for you, you might want to consider alternative alignment programs (switch to an alternative program).
You could also try to write the NCBI people who wrote the BLAST+ paper.

[fungs]

Yes thanks, I counterchecked with the latest BLAST+ version and found the same issue. The raw score is important to me because when I compare different aligners using the same scoring scheme should result in more or less the same alignments with the same raw scores.

Another point is that BLAST bit scores are calculated from the raw scores. This would mean that also the bit scores are slightly wrong!

I will write them an email, unfortunately they don't have a developers mailing list at the NCBI...

[fungs]

Just to let you know: Here is some evidence on the issue. I checked different versions and engines of NCBI BLAST. This seems to be an optimization in the code that is on purpose. The effect is that raw score can differ up to 3 points from real score.

blast2.2.24+:

* * * <Parameters_expect>10000</Parameters_expect>
* * * <Parameters_sc-match>2</Parameters_sc-match>
* * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
* * * <Parameters_gap-open>5</Parameters_gap-open>
* * * <Parameters_gap-extend>2</Parameters_gap-extend>
* * * <Parameters_filter>F</Parameters_filter>

* * * * * * * <Hsp_num>1</Hsp_num>
* * * * * * * <Hsp_bit-score>176.213077892943</Hsp_bit-score>
* * * * * * * <Hsp_score>194</Hsp_score>
* * * * * * * <Hsp_evalue>6.28580662796915e-42</Hsp_evalue>
* * * * * * * <Hsp_query-from>1</Hsp_query-from>
* * * * * * * <Hsp_query-to>100</Hsp_query-to>
* * * * * * * <Hsp_hit-from>108</Hsp_hit-from>
* * * * * * * <Hsp_hit-to>9</Hsp_hit-to>
* * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
* * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
* * * * * * * <Hsp_identity>99</Hsp_identity>
* * * * * * * <Hsp_positive>99</Hsp_positive>
* * * * * * * <Hsp_gaps>0</Hsp_gaps>
* * * * * * * <Hsp_align-len>100</Hsp_align-len>
* * * * * * *
<Hsp_qseq>TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGCGTGA</Hsp_qseq>
* * * * * * *
<Hsp_hseq>TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGTGTGA</Hsp_hseq>
* * * * * * *
<Hsp_midline>||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
</Hsp_midline>

================================================================================
blast2.2.24:

* * * <Parameters_expect>10000</Parameters_expect>
* * * <Parameters_sc-match>2</Parameters_sc-match>
* * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
* * * <Parameters_gap-open>5</Parameters_gap-open>
* * * <Parameters_gap-extend>2</Parameters_gap-extend>
* * * <Parameters_filter>F</Parameters_filter>

* * * * * * * <Hsp_num>1</Hsp_num>
* * * * * * * <Hsp_bit-score>176.213</Hsp_bit-score>
* * * * * * * <Hsp_score>194</Hsp_score>
* * * * * * * <Hsp_evalue>6.28581e-42</Hsp_evalue>
* * * * * * * <Hsp_query-from>100</Hsp_query-from>
* * * * * * * <Hsp_query-to>1</Hsp_query-to>
* * * * * * * <Hsp_hit-from>9</Hsp_hit-from>
* * * * * * * <Hsp_hit-to>108</Hsp_hit-to>
* * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
* * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
* * * * * * * <Hsp_identity>99</Hsp_identity>
* * * * * * * <Hsp_positive>99</Hsp_positive>
* * * * * * * <Hsp_align-len>100</Hsp_align-len>
* * * * * * *
<Hsp_qseq>TCACGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_qseq>
* * * * * * *
<Hsp_hseq>TCACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_hseq>
* * * * * * *
<Hsp_midline>|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
</Hsp_midline>

================================================================================

blast2.2.24-legacy:

* * * <Parameters_expect>10000</Parameters_expect>
* * * <Parameters_sc-match>2</Parameters_sc-match>
* * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
* * * <Parameters_gap-open>5</Parameters_gap-open>
* * * <Parameters_gap-extend>2</Parameters_gap-extend>
* * * <Parameters_filter>F</Parameters_filter>

* * * * * * * <Hsp_num>1</Hsp_num>
* * * * * * * <Hsp_bit-score>177.115</Hsp_bit-score>
* * * * * * * <Hsp_score>195</Hsp_score>
* * * * * * * <Hsp_evalue>3.36455e-42</Hsp_evalue>
* * * * * * * <Hsp_query-from>100</Hsp_query-from>
* * * * * * * <Hsp_query-to>1</Hsp_query-to>
* * * * * * * <Hsp_hit-from>9</Hsp_hit-from>
* * * * * * * <Hsp_hit-to>108</Hsp_hit-to>
* * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
* * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
* * * * * * * <Hsp_identity>99</Hsp_identity>
* * * * * * * <Hsp_positive>99</Hsp_positive>
* * * * * * * <Hsp_align-len>100</Hsp_align-len>
* * * * * * *
<Hsp_qseq>TCACGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_qseq>
* * * * * * *
<Hsp_hseq>TCACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_hseq>
* * * * * * *
<Hsp_midline>|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
</Hsp_midline>