Here I am using AMOS-Hybrid, where mates file is required. For mira I know we dont need mates file, what we need there is a caf file from an initial assembly and sequence file from the second technology.
Can anybody correct me on the mates file, mentioned above. When I use this, the error log shows a large number of reads got excluded.
I want to know specifically the regular expression for the library and for the forward and reverse reads, I have mentioned the description of forward and reverse reads above.
Regards,
Intikhab
Unconfigured Ad
Collapse
X
-
I suggest checking MIRA again, I think that you are in error in thinking that it requires mates files. I have used MIRA with good results doing hybrid assemblies of single end read 454 and illumina data. See the thread: "Combining 454FLX and SOLiD runs for de novo genome assembly", I outlined the process that I used there.
SBB
Leave a comment:
-
About the mates file, if I have the following description of the paired ends reads:
>NG-5247_HLP_3_1_1058_5238/1
ATGATGCATCTGAGACGATNGGTGTAAACGATCGT
>NG-5247_HLP_3_1_1058_5238/2
ACAAGATATATACGTATTATTAGGGTCAATAATGG
How should the mates file look a like?:
library NG-5247 150 200 (^NG).*
pair (.*)\/1 (.*)\/2
One related question. When we have two separate files for paired end reads, how can one provide these to mira or AMOS-Hybrid, these programs require one file. Does, jut combining the two e.g. using cat a b >c should do?
Intikhab
Originally posted by andreas.sjodin View PostI would refer you to the BAMBUS manual where you find a description of the mates format:
Download AMOS for free. AMOS is a collection of tools for genome assembly. AMOS is a collection of tools and class interfaces for the assembly of DNA reads. The package includes a robust infrastructure, modular assembly pipelines, and tools for overlapping, consensus generation, contigging, and assembly manipulation.
You may also find an example in the test folder of AMOS-Hybrid.
The first row describes the library information and the second row contains mate-pair relationships. You may create your own mate-file based on information your own library and read structure.
Leave a comment:
-
If you wanted to use Mira, there are instructions on how to directly use Mira with Bambus:Originally posted by intikhab View PostHi,
I have managed to get a reasonable assembly of a bacterial genome using newbler based on 454 NG sequence data.
I have also available paired end reads for the same bacterial genome and I am wondering is there a way to improve the contigs and scaffolding.
Leave a comment:
-
I would refer you to the BAMBUS manual where you find a description of the mates format:
Download AMOS for free. AMOS is a collection of tools for genome assembly. AMOS is a collection of tools and class interfaces for the assembly of DNA reads. The package includes a robust infrastructure, modular assembly pipelines, and tools for overlapping, consensus generation, contigging, and assembly manipulation.
You may also find an example in the test folder of AMOS-Hybrid.
The first row describes the library information and the second row contains mate-pair relationships. You may create your own mate-file based on information your own library and read structure.library fiveK 4000 6000 (r).*
pair (.*)\.1 (.*)\.2
Leave a comment:
-
Denovo Hybrid Assembly using 454/illumina
Hi,
I have managed to get a reasonable assembly of a bacterial genome using newbler based on 454 NG sequence data.
I have also available paired end reads for the same bacterial genome and I am wondering is there a way to improve the contigs and scaffolding.
I read about AMOS-hybrid, http://www.biomedcentral.com/1471-2164/11/242, but it requires mates file, which I do not have available instead I have one sequence file for each of the paired ends.
I also thought to try mira but it also requires mates files. Should I request the vender for mates file or there are other software available that can use contigs from my newbler run and raw paired end files and their qualities?
I hope other people may have gone through hybrid assembly issue already and may be of help.
Regards,
Intikhab
Latest Articles
Collapse
-
by SEQadmin2
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...-
Channel: Articles
-
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 09-29-2026, 09:51 AM
|
0 responses
22 views
0 reactions
|
Last Post
by SEQadmin2
09-29-2026, 09:51 AM
|
||
|
Started by SEQadmin2, 09-25-2026, 09:06 AM
|
0 responses
42 views
0 reactions
|
Last Post
by SEQadmin2
09-25-2026, 09:06 AM
|
||
|
Started by SEQadmin2, 09-23-2026, 11:05 AM
|
0 responses
33 views
0 reactions
|
Last Post
by SEQadmin2
09-23-2026, 11:05 AM
|
||
|
Started by SEQadmin2, 09-18-2026, 11:37 AM
|
1 response
50 views
0 reactions
|
Last Post
by pekgio
09-21-2026, 02:04 AM
|
Leave a comment: