[ffinkernagel]

yeah, that's what the line with grep is supposed to check-whether that string abyss complains about is in there.

[Seta]

how long should that take..hours or just minutes...mine is already bussy for an hour...

[ffinkernagel]

Well, for a 1.2 gig file (compressed), my machine needed about 3 minutes (transfering it on a gigabit network) for doing the 'gzip -cd | grep' stanca.

[Seta]

I don't get any output at all, if I use the line:
gzip -cd s_7_sequence.fastq.gz | grep "Ms_7_sequence.txt"
But I also already thought that there wouldn't be a line with "Ms_7_sequence.txt"....

[ffinkernagel]

Yes, no output is what you would get if there was no 'Ms_7_sequence.txt' in there.

Curiouser and curiouser - have you tried passing the un-gziped file (gzip -d name.fastq.gz) to AbySS?

[Seta]

That is weird!!! the last time I tried it din't work and now it is reading the file! I'll cross my fingers and hope for the best. Do you have any idea how long it could take? I read somewhere that it can take between 3 and 10 hours...

[ffinkernagel]

that depends.
What exactly are you trying to assemble, how many reads do you have, etc?.

Generally, assembly can take a long (long) time.

[Dorisday81]

Hi all, I'm new here and have a problem.
Maybe its not right place to write but I can not write new post.

I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.

I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;

My input was file with contigs (after format: fastanrdb) with FASTA extenstion.

I got from ABYSS analysis files. They looks like (examples):

>0 31 117
AGACTTCCCAACATTTATTGCTCTTTCTCTT
>1 35 79
ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
>2 27 60
ATGAATTCTATTGGAGAATGTACATTA
>3 44 666
TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
>4 111 1332
GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
>5 18 31
GGAGTGTCGATGCTTGAA
>6 38 213
GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA


I have problem with next step of analysis-the trans-Abyss

In manual guide I read that the trans abyss needs specific folder structure.

I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)

I dont know what is next?

sorry for so complicates question but I am so sad sitting, reading and nothing.....