yeah, that's what the line with grep is supposed to check-whether that string abyss complains about is in there.
Unconfigured Ad
Collapse
X
-
Hi all, I'm new here and have a problem.
Maybe its not right place to write but I can not write new post.
I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.
I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;
My input was file with contigs (after format: fastanrdb) with FASTA extenstion.
I got from ABYSS analysis files. They looks like (examples):
>0 31 117
AGACTTCCCAACATTTATTGCTCTTTCTCTT
>1 35 79
ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
>2 27 60
ATGAATTCTATTGGAGAATGTACATTA
>3 44 666
TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
>4 111 1332
GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
>5 18 31
GGAGTGTCGATGCTTGAA
>6 38 213
GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA
I have problem with next step of analysis-the trans-Abyss
In manual guide I read that the trans abyss needs specific folder structure.
I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)
I dont know what is next?
sorry for so complicates question but I am so sad sitting, reading and nothing.....
Comment
-
Latest Articles
Collapse
-
by SEQadmin2
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...-
Channel: Articles
07-09-2026, 11:10 AM -
-
by SEQadmin2
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...-
Channel: Articles
07-08-2026, 05:17 AM -
-
by GATTACATLove this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
-
Channel: Articles
07-01-2026, 11:43 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 07-13-2026, 10:26 AM
|
0 responses
22 views
0 reactions
|
Last Post
by SEQadmin2
07-13-2026, 10:26 AM
|
||
|
Started by SEQadmin2, 07-09-2026, 10:04 AM
|
0 responses
32 views
0 reactions
|
Last Post
by SEQadmin2
07-09-2026, 10:04 AM
|
||
|
Started by SEQadmin2, 07-08-2026, 10:08 AM
|
0 responses
20 views
0 reactions
|
Last Post
by SEQadmin2
07-08-2026, 10:08 AM
|
||
|
Started by SEQadmin2, 07-07-2026, 11:05 AM
|
0 responses
34 views
0 reactions
|
Last Post
by SEQadmin2
07-07-2026, 11:05 AM
|
Comment