Tweet
yeah, that's what the line with grep is supposed to check-whether that string abyss complains about is in there.
-
-
how long should that take..hours or just minutes...mine is already bussy for an hour...Comment
-
Well, for a 1.2 gig file (compressed), my machine needed about 3 minutes (transfering it on a gigabit network) for doing the 'gzip -cd | grep' stanca.Comment
-
I don't get any output at all, if I use the line:
gzip -cd s_7_sequence.fastq.gz | grep "Ms_7_sequence.txt"
But I also already thought that there wouldn't be a line with "Ms_7_sequence.txt"....Comment
-
Yes, no output is what you would get if there was no 'Ms_7_sequence.txt' in there.
Curiouser and curiouser - have you tried passing the un-gziped file (gzip -d name.fastq.gz) to AbySS?Comment
-
That is weird!!! the last time I tried it din't work and now it is reading the file! I'll cross my fingers and hope for the best. Do you have any idea how long it could take? I read somewhere that it can take between 3 and 10 hours...Comment
-
that depends.
What exactly are you trying to assemble, how many reads do you have, etc?.
Generally, assembly can take a long (long) time.Comment
-
Hi all, I'm new here and have a problem.
Maybe its not right place to write but I can not write new post.
I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.
I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;
My input was file with contigs (after format: fastanrdb) with FASTA extenstion.
I got from ABYSS analysis files. They looks like (examples):
>0 31 117
AGACTTCCCAACATTTATTGCTCTTTCTCTT
>1 35 79
ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
>2 27 60
ATGAATTCTATTGGAGAATGTACATTA
>3 44 666
TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
>4 111 1332
GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
>5 18 31
GGAGTGTCGATGCTTGAA
>6 38 213
GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA
I have problem with next step of analysis-the trans-Abyss
In manual guide I read that the trans abyss needs specific folder structure.
I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)
I dont know what is next?
sorry for so complicates question but I am so sad sitting, reading and nothing.....Comment
-
Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.
The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...06-02-2026, 10:05 AM -
With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.
Introduction
Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...05-22-2026, 06:42 AM
Comment