yeah, that's what the line with grep is supposed to check-whether that string abyss complains about is in there.
-
-
how long should that take..hours or just minutes...mine is already bussy for an hour...Comment
-
Well, for a 1.2 gig file (compressed), my machine needed about 3 minutes (transfering it on a gigabit network) for doing the 'gzip -cd | grep' stanca.Comment
-
I don't get any output at all, if I use the line:
gzip -cd s_7_sequence.fastq.gz | grep "Ms_7_sequence.txt"
But I also already thought that there wouldn't be a line with "Ms_7_sequence.txt"....Comment
-
Yes, no output is what you would get if there was no 'Ms_7_sequence.txt' in there.
Curiouser and curiouser - have you tried passing the un-gziped file (gzip -d name.fastq.gz) to AbySS?Comment
-
That is weird!!! the last time I tried it din't work and now it is reading the file! I'll cross my fingers and hope for the best. Do you have any idea how long it could take? I read somewhere that it can take between 3 and 10 hours...Comment
-
that depends.
What exactly are you trying to assemble, how many reads do you have, etc?.
Generally, assembly can take a long (long) time.Comment
-
Hi all, I'm new here and have a problem.
Maybe its not right place to write but I can not write new post.
I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.
I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;
My input was file with contigs (after format: fastanrdb) with FASTA extenstion.
I got from ABYSS analysis files. They looks like (examples):
>0 31 117
AGACTTCCCAACATTTATTGCTCTTTCTCTT
>1 35 79
ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
>2 27 60
ATGAATTCTATTGGAGAATGTACATTA
>3 44 666
TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
>4 111 1332
GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
>5 18 31
GGAGTGTCGATGCTTGAA
>6 38 213
GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA
I have problem with next step of analysis-the trans-Abyss
In manual guide I read that the trans abyss needs specific folder structure.
I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)
I dont know what is next?
sorry for so complicates question but I am so sad sitting, reading and nothing.....Comment
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment